BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.623
(863 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL373908.1|AL373908 MtBB03E08F1 MtBB Medicago truncatula... 48 0.001
gb|BF637655.1|BF637655 NF032B07PL1F1059 Phosphate starved l... 48 0.001
gb|CX524368.1|CX524368 s13dNF15A03AT017_448080 Aphid-Infect... 48 0.001
gb|DW017022.1|DW017022 EST1225983 MTY Medicago truncatula c... 48 0.001
gb|AC134242.17| Medicago truncatula clone mth2-10p20, compl... 48 0.001
gb|AL379945.1|AL379945 MtBB48D05R1 MtBB Medicago truncatula... 42 0.076
gb|AW775786.1|AW775786 EST334851 DSIL Medicago truncatula c... 40 0.30
gb|AW775871.1|AW775871 EST334936 DSIL Medicago truncatula c... 40 0.30
gb|BE124733.1|BE124733 EST393768 GVN Medicago truncatula cD... 40 0.30
gb|BE240458.1|BE240458 EST404507 MHRP- Medicago truncatula ... 40 0.30
gb|AL374421.1|AL374421 MtBB06E05F1 MtBB Medicago truncatula... 40 0.30
gb|AL379653.1|AL379653 MtBB46F04F1 MtBB Medicago truncatula... 40 0.30
gb|AL379654.1|AL379654 MtBB46F04R1 MtBB Medicago truncatula... 40 0.30
gb|AL379944.1|AL379944 MtBB48D05F1 MtBB Medicago truncatula... 40 0.30
gb|BE941229.1|BE941229 EST420808 MGHG Medicago truncatula c... 40 0.30
gb|BF636736.1|BF636736 NF072C11LF1F1083 Developing leaf Med... 40 0.30
gb|BF641623.1|BF641623 NF064E11IN1F1086 Insect herbivory Me... 40 0.30
gb|BG448975.1|BG448975 NF003H12IN1F1104 Insect herbivory Me... 40 0.30
gb|BG451829.1|BG451829 NF100H10DT1F1089 Drought Medicago tr... 40 0.30
gb|BG454549.1|BG454549 NF101D02LF1F1014 Developing leaf Med... 40 0.30
gb|BG646329.1|BG646329 EST507948 HOGA Medicago truncatula c... 40 0.30
gb|CB894134.1|CB894134 EST646926 HOGA Medicago truncatula c... 40 0.30
gb|AJ847011.1|AJ847011 AJ847011 MtSTW Medicago truncatula c... 40 0.30
gb|AJ847287.1|AJ847287 AJ847287 MtSTW Medicago truncatula c... 40 0.30
gb|AC146705.11| Medicago truncatula clone mth2-101f3, compl... 40 0.30
>gb|AL373908.1|AL373908 MtBB03E08F1 MtBB Medicago truncatula cDNA clone MtBB03E08 T3, mRNA
sequence
Length = 327
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
|||||||||||||||||||| || || || || |||||||||||
Sbjct: 11 gttgagtaccgttgcttcgtcggaggtcttgcatgggccaccga 54
>gb|BF637655.1|BF637655 NF032B07PL1F1059 Phosphate starved leaf Medicago truncatula cDNA
clone NF032B07PL 5', mRNA sequence
Length = 432
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
|||||||||||||||||||| || || || || |||||||||||
Sbjct: 45 gttgagtaccgttgcttcgtcggaggtcttgcatgggccaccga 88
>gb|CX524368.1|CX524368 s13dNF15A03AT017_448080 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 415
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
|||||||||||||||||||| || || || || |||||||||||
Sbjct: 54 gttgagtaccgttgcttcgtcggaggtcttgcatgggccaccga 97
>gb|DW017022.1|DW017022 EST1225983 MTY Medicago truncatula cDNA clone MTYAO52, mRNA
sequence
Length = 792
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
|||||||||||||||||||| || || || || |||||||||||
Sbjct: 76 gttgagtaccgttgcttcgtcggaggtcttgcatgggccaccga 119
>gb|AC134242.17| Medicago truncatula clone mth2-10p20, complete sequence
Length = 115005
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
|||||||||||||||||||| || || || || |||||||||||
Sbjct: 57857 gttgagtaccgttgcttcgtcggaggtcttgcatgggccaccga 57900
Score = 40.1 bits (20), Expect = 0.30
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
||||| |||||||||||||| || || || || |||||||||||
Sbjct: 75090 gttgaataccgttgcttcgtcggaggtcttgcatgggccaccga 75133
>gb|AL379945.1|AL379945 MtBB48D05R1 MtBB Medicago truncatula cDNA clone MtBB48D05 T7, mRNA
sequence
Length = 534
Score = 42.1 bits (21), Expect = 0.076
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 487 ggctacggcggtggtcgtggaggctacggcggcggtgggggatac 531
||||||||||| ||| ||||| | ||||||||||||| ||||||
Sbjct: 137 ggctacggcggcggtggtggatacaacggcggcggtggtggatac 181
>gb|AW775786.1|AW775786 EST334851 DSIL Medicago truncatula cDNA clone pDSIL-3K7, mRNA
sequence
Length = 606
Score = 40.1 bits (20), Expect = 0.30
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
||||| |||||||||||||| || || || || |||||||||||
Sbjct: 22 gttgaataccgttgcttcgtcggaggtcttgcatgggccaccga 65
>gb|AW775871.1|AW775871 EST334936 DSIL Medicago truncatula cDNA clone pDSIL-3I20, mRNA
sequence
Length = 710
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 394 ggctacggcggcggtggtggatac 417
>gb|BE124733.1|BE124733 EST393768 GVN Medicago truncatula cDNA clone pGVN-67B7, mRNA
sequence
Length = 580
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 489 ggctacggcggcggtggtggatac 512
>gb|BE240458.1|BE240458 EST404507 MHRP- Medicago truncatula cDNA clone pMHRP-45A20, mRNA
sequence
Length = 433
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 156 ggctacggcggcggtggtggatac 179
>gb|AL374421.1|AL374421 MtBB06E05F1 MtBB Medicago truncatula cDNA clone MtBB06E05 T3, mRNA
sequence
Length = 310
Score = 40.1 bits (20), Expect = 0.30
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
||||| |||||||||||||| || || || || |||||||||||
Sbjct: 8 gttgaataccgttgcttcgtcggaggtcttgcatgggccaccga 51
>gb|AL379653.1|AL379653 MtBB46F04F1 MtBB Medicago truncatula cDNA clone MtBB46F04 T3, mRNA
sequence
Length = 374
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 338 ggctacggcggcggtggtggatac 361
>gb|AL379654.1|AL379654 MtBB46F04R1 MtBB Medicago truncatula cDNA clone MtBB46F04 T7, mRNA
sequence
Length = 496
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 140 ggctacggcggcggtggtggatac 163
>gb|AL379944.1|AL379944 MtBB48D05F1 MtBB Medicago truncatula cDNA clone MtBB48D05 T3, mRNA
sequence
Length = 478
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 435 ggctacggcggcggtggtggatac 458
>gb|BE941229.1|BE941229 EST420808 MGHG Medicago truncatula cDNA clone pMGHG-3G2, mRNA
sequence
Length = 344
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 48 ggctacggcggcggtggtggatac 71
>gb|BF636736.1|BF636736 NF072C11LF1F1083 Developing leaf Medicago truncatula cDNA clone
NF072C11LF 5', mRNA sequence
Length = 602
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 450 ggctacggcggcggtggtggatac 473
>gb|BF641623.1|BF641623 NF064E11IN1F1086 Insect herbivory Medicago truncatula cDNA clone
NF064E11IN 5', mRNA sequence
Length = 661
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 450 ggctacggcggcggtggtggatac 473
>gb|BG448975.1|BG448975 NF003H12IN1F1104 Insect herbivory Medicago truncatula cDNA clone
NF003H12IN 5', mRNA sequence
Length = 393
Score = 40.1 bits (20), Expect = 0.30
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
||||| |||||||||||||| || || || || |||||||||||
Sbjct: 38 gttgaataccgttgcttcgtcggaggtcttgcatgggccaccga 81
>gb|BG451829.1|BG451829 NF100H10DT1F1089 Drought Medicago truncatula cDNA clone NF100H10DT
5', mRNA sequence
Length = 527
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 466 ggctacggcggtggcggtgg 485
||||||||||||||||||||
Sbjct: 356 ggctacggcggtggcggtgg 375
>gb|BG454549.1|BG454549 NF101D02LF1F1014 Developing leaf Medicago truncatula cDNA clone
NF101D02LF 5', mRNA sequence
Length = 612
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 466 ggctacggcggtggcggtgg 485
||||||||||||||||||||
Sbjct: 356 ggctacggcggtggcggtgg 375
>gb|BG646329.1|BG646329 EST507948 HOGA Medicago truncatula cDNA clone pHOGA-7A24 5' end,
mRNA sequence
Length = 458
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 173 ggctacggcggcggtggtggatac 196
>gb|CB894134.1|CB894134 EST646926 HOGA Medicago truncatula cDNA clone HOGA-30M17, mRNA
sequence
Length = 527
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 245 ggctacggcggcggtggtggatac 268
>gb|AJ847011.1|AJ847011 AJ847011 MtSTW Medicago truncatula cDNA clone MtTW03F21N1, mRNA
sequence
Length = 326
Score = 40.1 bits (20), Expect = 0.30
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
||||| |||||||||||||| || || || || |||||||||||
Sbjct: 17 gttgaataccgttgcttcgtcggaggtcttgcatgggccaccga 60
>gb|AJ847287.1|AJ847287 AJ847287 MtSTW Medicago truncatula cDNA clone MtTW07M24N2, mRNA
sequence
Length = 437
Score = 40.1 bits (20), Expect = 0.30
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccaccga 209
||||| |||||||||||||| || || || || |||||||||||
Sbjct: 43 gttgaataccgttgcttcgtcggaggtcttgcatgggccaccga 86
>gb|AC146705.11| Medicago truncatula clone mth2-101f3, complete sequence
Length = 120058
Score = 40.1 bits (20), Expect = 0.30
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 508 ggctacggcggcggtgggggatac 531
||||||||||||||||| ||||||
Sbjct: 96593 ggctacggcggcggtggtggatac 96570
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 123,608
Number of Sequences: 392609
Number of extensions: 123608
Number of successful extensions: 14781
Number of sequences better than 0.5: 27
Number of HSP's better than 0.5 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14661
Number of HSP's gapped (non-prelim): 118
length of query: 863
length of database: 441,732,993
effective HSP length: 20
effective length of query: 843
effective length of database: 433,880,813
effective search space: 365761525359
effective search space used: 365761525359
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)