BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.387
(908 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|CR297089.1| mte1-14C3RM1 BAC end, cultivar Jemalong A17... 56 5e-006
gb|AW267781.1|AW267781 EST305909 DSIR Medicago truncatula c... 56 5e-006
gb|AW559461.1|AW559461 EST314509 DSIR Medicago truncatula c... 56 5e-006
gb|AW560047.1|AW560047 EST315095 DSIR Medicago truncatula c... 56 5e-006
gb|AW560048.1|AW560048 EST315096 DSIR Medicago truncatula c... 56 5e-006
gb|AW560177.1|AW560177 EST315225 DSIR Medicago truncatula c... 56 5e-006
gb|AW560867.1|AW560867 EST315915 DSIR Medicago truncatula c... 56 5e-006
gb|AW685138.1|AW685138 NF025D08NR1F1000 Nodulated root Medi... 56 5e-006
gb|BE997567.1|BE997567 EST429290 GVSN Medicago truncatula c... 56 5e-006
gb|BF632056.1|BF632056 NF040G09DT1F1069 Drought Medicago tr... 56 5e-006
gb|BF633283.1|BF633283 NF047D03DT1F1028 Drought Medicago tr... 56 5e-006
gb|BF636360.1|BF636360 NF089E04DT1F1034 Drought Medicago tr... 56 5e-006
gb|BF636395.1|BF636395 NF090A04DT1F1024 Drought Medicago tr... 56 5e-006
gb|BF637904.1|BF637904 NF029F08PL1F1073 Phosphate starved l... 56 5e-006
gb|BF638282.1|BF638282 NF053C09PL1F1068 Phosphate starved l... 56 5e-006
gb|BF646033.1|BF646033 NF043A03EC1F1020 Elicited cell cultu... 56 5e-006
gb|BF646362.1|BF646362 NF071A12EC1F1088 Elicited cell cultu... 56 5e-006
gb|BF650277.1|BF650277 NF087B10EC1F1079 Elicited cell cultu... 56 5e-006
gb|AW687771.2|AW687771 NF013C08RT1F1065 Developing root Med... 56 5e-006
gb|AW685242.2|AW685242 NF028A07NR1F1000 Nodulated root Medi... 56 5e-006
gb|BG447813.1|BG447813 NF103E05EC1F1037 Elicited cell cultu... 56 5e-006
gb|BG452415.1|BG452415 NF099G05LF1F1037 Developing leaf Med... 56 5e-006
gb|BG452980.1|BG452980 NF086F05LF1F1044 Developing leaf Med... 56 5e-006
gb|BQ165427.1|BQ165427 EST611296 KVKC Medicago truncatula c... 56 5e-006
gb|BQ165428.1|BQ165428 EST611297 KVKC Medicago truncatula c... 56 5e-006
gb|AJ501010.1|AJ501010 AJ501010 MTAMP Medicago truncatula c... 56 5e-006
gb|AJ501186.1|AJ501186 AJ501186 MTAMP Medicago truncatula c... 56 5e-006
gb|AJ501743.1|AJ501743 AJ501743 MTAMP Medicago truncatula c... 56 5e-006
gb|AJ502049.1|AJ502049 AJ502049 MTAMP Medicago truncatula c... 56 5e-006
gb|CB892183.1|CB892183 EST649152 KV3 Medicago truncatula cD... 56 5e-006
gb|CB893707.1|CB893707 EST646499 HOGA Medicago truncatula c... 56 5e-006
gb|CB893753.1|CB893753 EST646545 HOGA Medicago truncatula c... 56 5e-006
gb|CB895070.1|CB895070 EST647862 HOGA Medicago truncatula c... 56 5e-006
gb|AJ500330.1|AJ500330 AJ500330 MTGIM Medicago truncatula c... 56 5e-006
gb|DW015521.1|DW015521 EST1224482 MTY Medicago truncatula c... 56 5e-006
gb|AC121239.34| Medicago truncatula clone mth1-8p19, comple... 56 5e-006
emb|Y10373.1|MTCHITIN1 M.truncatula mRNA for chitinase 56 5e-006
emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1... 56 5e-006
gb|BQ153545.1|BQ153545 NF039H01IR1F1015 Irradiated Medicago... 52 8e-005
gb|AW684371.1|AW684371 NF016B09NR1F1000 Nodulated root Medi... 50 3e-004
gb|AJ548267.1|AJ548267 AJ548267 MTAPHEU Medicago truncatula... 48 0.001
gb|AF167323.1|AF167323 Medicago truncatula clone T130002g p... 48 0.001
gb|AC148763.14| Medicago truncatula clone mth2-29o24, compl... 48 0.001
gb|AL382691.1|AL382691 MtBC09D09F1 MtBC Medicago truncatula... 44 0.020
gb|BE942180.1|BE942180 EST421759 MGHG Medicago truncatula c... 44 0.020
gb|BE943303.1|BE943303 EST422882 MGHG Medicago truncatula c... 44 0.020
gb|BE997667.1|BE997667 EST429390 GVSN Medicago truncatula c... 44 0.020
gb|BF632801.1|BF632801 NF051E02DT1F1008 Drought Medicago tr... 44 0.020
gb|BG455179.1|BG455179 NF068B09PL1F1075 Phosphate starved l... 44 0.020
gb|BQ152522.1|BQ152522 NF019F07IR1F1061 Irradiated Medicago... 44 0.020
gb|BQ155216.1|BQ155216 NF077E04IR1F1035 Irradiated Medicago... 44 0.020
gb|BQ157165.1|BQ157165 NF101F12IR1F1103 Irradiated Medicago... 44 0.020
gb|CX531641.1|CX531641 s13dNF80C04MJ022_257227 Methyl Jasmo... 44 0.020
gb|BG449009.1|BG449009 NF003G12IN1F1100 Insect herbivory Me... 42 0.080
gb|BI269537.1|BI269537 NF004F09IR1F1078 Irradiated Medicago... 42 0.080
gb|BQ143906.1|BQ143906 NF037F02DT1F1016 Drought Medicago tr... 42 0.080
gb|BQ153299.1|BQ153299 NF033G05IR1F1038 Irradiated Medicago... 42 0.080
gb|BQ155428.1|BQ155428 NF080D07IR1F1062 Irradiated Medicago... 42 0.080
gb|BQ155812.1|BQ155812 NF084E11IR1F1087 Irradiated Medicago... 42 0.080
gb|BQ155892.1|BQ155892 NF085D01IR1F1014 Irradiated Medicago... 42 0.080
gb|BQ155911.1|BQ155911 NF085F02IR1F1027 Irradiated Medicago... 42 0.080
gb|BQ156286.1|BQ156286 NF091C01IR1F1006 Irradiated Medicago... 42 0.080
gb|BQ165638.1|BQ165638 EST611507 KVKC Medicago truncatula c... 42 0.080
gb|CX517163.1|CX517163 s13dNF14D07VI062_398797 Virus-Infect... 42 0.080
gb|CX517299.1|CX517299 s13dNF07C08VI066_399617 Virus-Infect... 42 0.080
gb|CX520567.1|CX520567 s13dNF57C09VI068_448920 Virus-Infect... 42 0.080
gb|CX523055.1|CX523055 s13dNF88B10VI089_471914 Virus-Infect... 42 0.080
gb|CA921973.1|CA921973 EST639691 MTUS Medicago truncatula c... 40 0.32
>emb|CR297089.1| mte1-14C3RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 328
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 54 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 113
>gb|AW267781.1|AW267781 EST305909 DSIR Medicago truncatula cDNA clone pDSIR-8C11, mRNA
sequence
Length = 699
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 469 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 410
>gb|AW559461.1|AW559461 EST314509 DSIR Medicago truncatula cDNA clone pDSIR-19M3, mRNA
sequence
Length = 604
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 454 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 395
>gb|AW560047.1|AW560047 EST315095 DSIR Medicago truncatula cDNA clone pDSIR-26G13, mRNA
sequence
Length = 629
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 381 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 322
Score = 42.1 bits (21), Expect = 0.080
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 572 ggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 623 ggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 575
>gb|AW560048.1|AW560048 EST315096 DSIR Medicago truncatula cDNA clone pDSIR-26G13, mRNA
sequence
Length = 738
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 458 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 399
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 709 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 652
>gb|AW560177.1|AW560177 EST315225 DSIR Medicago truncatula cDNA clone pDSIR-26G20, mRNA
sequence
Length = 661
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 457 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 398
>gb|AW560867.1|AW560867 EST315915 DSIR Medicago truncatula cDNA clone pDSIR-30O7, mRNA
sequence
Length = 598
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 463 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 404
>gb|AW685138.1|AW685138 NF025D08NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF025D08NR 5', mRNA sequence
Length = 642
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 477 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 418
>gb|BE997567.1|BE997567 EST429290 GVSN Medicago truncatula cDNA clone pGVSN-1B17, mRNA
sequence
Length = 493
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 133 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 74
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 384 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 327
>gb|BF632056.1|BF632056 NF040G09DT1F1069 Drought Medicago truncatula cDNA clone NF040G09DT
5', mRNA sequence
Length = 551
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 478 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 419
>gb|BF633283.1|BF633283 NF047D03DT1F1028 Drought Medicago truncatula cDNA clone NF047D03DT
5', mRNA sequence
Length = 601
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 478 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 419
>gb|BF636360.1|BF636360 NF089E04DT1F1034 Drought Medicago truncatula cDNA clone NF089E04DT
5', mRNA sequence
Length = 609
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 484 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 425
>gb|BF636395.1|BF636395 NF090A04DT1F1024 Drought Medicago truncatula cDNA clone NF090A04DT
5', mRNA sequence
Length = 656
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 486 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 427
>gb|BF637904.1|BF637904 NF029F08PL1F1073 Phosphate starved leaf Medicago truncatula cDNA
clone NF029F08PL 5', mRNA sequence
Length = 642
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 303 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 244
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 554 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 497
>gb|BF638282.1|BF638282 NF053C09PL1F1068 Phosphate starved leaf Medicago truncatula cDNA
clone NF053C09PL 5', mRNA sequence
Length = 649
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 303 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 244
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 554 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 497
>gb|BF646033.1|BF646033 NF043A03EC1F1020 Elicited cell culture Medicago truncatula cDNA
clone NF043A03EC 5', mRNA sequence
Length = 647
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 480 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 421
>gb|BF646362.1|BF646362 NF071A12EC1F1088 Elicited cell culture Medicago truncatula cDNA
clone NF071A12EC 5', mRNA sequence
Length = 670
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 484 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 425
>gb|BF650277.1|BF650277 NF087B10EC1F1079 Elicited cell culture Medicago truncatula cDNA
clone NF087B10EC 5', mRNA sequence
Length = 610
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 306 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 247
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 557 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 500
>gb|AW687771.2|AW687771 NF013C08RT1F1065 Developing root Medicago truncatula cDNA clone
NF013C08RT 5', mRNA sequence
Length = 584
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 121 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 62
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 372 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 315
>gb|AW685242.2|AW685242 NF028A07NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF028A07NR 5', mRNA sequence
Length = 645
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 471 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 412
>gb|BG447813.1|BG447813 NF103E05EC1F1037 Elicited cell culture Medicago truncatula cDNA
clone NF103E05EC 5', mRNA sequence
Length = 681
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 479 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 420
>gb|BG452415.1|BG452415 NF099G05LF1F1037 Developing leaf Medicago truncatula cDNA clone
NF099G05LF 5', mRNA sequence
Length = 688
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 473 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 414
>gb|BG452980.1|BG452980 NF086F05LF1F1044 Developing leaf Medicago truncatula cDNA clone
NF086F05LF 5', mRNA sequence
Length = 650
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 475 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 416
>gb|BQ165427.1|BQ165427 EST611296 KVKC Medicago truncatula cDNA clone pKVKC-9B4, mRNA
sequence
Length = 767
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 475 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 416
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 725 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 668
>gb|BQ165428.1|BQ165428 EST611297 KVKC Medicago truncatula cDNA clone pKVKC-9B4, mRNA
sequence
Length = 739
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 680 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 739
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 430 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 487
>gb|AJ501010.1|AJ501010 AJ501010 MTAMP Medicago truncatula cDNA clone mtgmadc120001f11,
mRNA sequence
Length = 671
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 517 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 458
>gb|AJ501186.1|AJ501186 AJ501186 MTAMP Medicago truncatula cDNA clone mtgmadc120003g09,
mRNA sequence
Length = 674
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 510 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 451
>gb|AJ501743.1|AJ501743 AJ501743 MTAMP Medicago truncatula cDNA clone mtgmadc120011c10,
mRNA sequence
Length = 577
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 496 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 437
>gb|AJ502049.1|AJ502049 AJ502049 MTAMP Medicago truncatula cDNA clone mtgmadc120015a03,
mRNA sequence
Length = 617
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 496 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 437
>gb|CB892183.1|CB892183 EST649152 KV3 Medicago truncatula cDNA clone KV3-53O18, mRNA
sequence
Length = 811
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 443 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 384
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 694 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 637
>gb|CB893707.1|CB893707 EST646499 HOGA Medicago truncatula cDNA clone HOGA-28D4, mRNA
sequence
Length = 810
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 375 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 316
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 626 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 569
>gb|CB893753.1|CB893753 EST646545 HOGA Medicago truncatula cDNA clone HOGA-28L14, mRNA
sequence
Length = 783
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 377 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 318
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 628 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 571
>gb|CB895070.1|CB895070 EST647862 HOGA Medicago truncatula cDNA clone HOGA-33B21, mRNA
sequence
Length = 532
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 133 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 74
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 384 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 327
>gb|AJ500330.1|AJ500330 AJ500330 MTGIM Medicago truncatula cDNA clone mtgmacc120015c02,
mRNA sequence
Length = 493
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 168 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 109
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 419 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 362
>gb|DW015521.1|DW015521 EST1224482 MTY Medicago truncatula cDNA clone MTYA631, mRNA
sequence
Length = 731
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 502 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 443
>gb|AC121239.34| Medicago truncatula clone mth1-8p19, complete sequence
Length = 100985
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 89607 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 89666
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 89356 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 89413
>emb|Y10373.1|MTCHITIN1 M.truncatula mRNA for chitinase
Length = 1315
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 486 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 427
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 737 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 680
>emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1H4 on chromosome 3, complete
sequence
Length = 100991
Score = 56.0 bits (28), Expect = 5e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 89604 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 89663
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 89353 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 89410
>gb|BQ153545.1|BQ153545 NF039H01IR1F1015 Irradiated Medicago truncatula cDNA clone
NF039H01IR 5', mRNA sequence
Length = 352
Score = 52.0 bits (26), Expect = 8e-005
Identities = 50/58 (86%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcg 829
|||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||
Sbjct: 115 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcg 58
>gb|AW684371.1|AW684371 NF016B09NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF016B09NR 5', mRNA sequence
Length = 640
Score = 50.1 bits (25), Expect = 3e-004
Identities = 51/60 (85%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| ||||||||||| ||||||| |||
Sbjct: 471 gcagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttngtg 412
>gb|AJ548267.1|AJ548267 AJ548267 MTAPHEU Medicago truncatula cDNA clone mtaehac110001b08,
mRNA sequence
Length = 269
Score = 48.1 bits (24), Expect = 0.001
Identities = 51/60 (85%)
Strand = Plus / Minus
Query: 772 gcagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
|||||||||||| ||| | || ||||| || ||||| |||||| |||| |||||||||||
Sbjct: 171 gcagtatccccaagcatatgggccatcaggtgcagttgcccattcacctgtggtttcgtg 112
>gb|AF167323.1|AF167323 Medicago truncatula clone T130002g putative chitinase gene, partial
cds
Length = 260
Score = 48.1 bits (24), Expect = 0.001
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 467 ccaccgttgatgatgttcgtggtcaggccgtatccgggga 506
||||||||||| ||||| ||| ||| ||||||||||||||
Sbjct: 165 ccaccgttgattatgttggtgatcacgccgtatccgggga 126
>gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete sequence
Length = 104879
Score = 48.1 bits (24), Expect = 0.001
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 467 ccaccgttgatgatgttcgtggtcaggccgtatccgggga 506
||||||||||| ||||| ||| ||| ||||||||||||||
Sbjct: 25105 ccaccgttgattatgttggtgatcacgccgtatccgggga 25144
Score = 42.1 bits (21), Expect = 0.080
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 470 ccgttgatgatgttcgtggtcaggccgtatccgggga 506
|||||||| ||||| ||| ||| ||||||||||||||
Sbjct: 29234 ccgttgattatgttggtgatcacgccgtatccgggga 29270
>gb|AL382691.1|AL382691 MtBC09D09F1 MtBC Medicago truncatula cDNA clone MtBC09D09 T3, mRNA
sequence
Length = 482
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 163 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 106
>gb|BE942180.1|BE942180 EST421759 MGHG Medicago truncatula cDNA clone pMGHG-7B24, mRNA
sequence
Length = 400
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 66 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 9
>gb|BE943303.1|BE943303 EST422882 MGHG Medicago truncatula cDNA clone pMGHG-15I16, mRNA
sequence
Length = 583
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 154 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 97
>gb|BE997667.1|BE997667 EST429390 GVSN Medicago truncatula cDNA clone pGVSN-1F10, mRNA
sequence
Length = 471
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 137 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 80
>gb|BF632801.1|BF632801 NF051E02DT1F1008 Drought Medicago truncatula cDNA clone NF051E02DT
5', mRNA sequence
Length = 437
Score = 44.1 bits (22), Expect = 0.020
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 794 ccatccggagcagtcgcccatccaccggtggtttcgtg 831
||||| || ||||| ||||||||||| |||||||||||
Sbjct: 427 ccatcaggtgcagttgcccatccacctgtggtttcgtg 390
>gb|BG455179.1|BG455179 NF068B09PL1F1075 Phosphate starved leaf Medicago truncatula cDNA
clone NF068B09PL 5', mRNA sequence
Length = 669
Score = 44.1 bits (22), Expect = 0.020
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 794 ccatccggagcagtcgcccatccaccggtggtttcgtg 831
||||| || ||||| ||||||||||| |||||||||||
Sbjct: 460 ccatcaggtgcagttgcccatccacctgtggtttcgtg 423
>gb|BQ152522.1|BQ152522 NF019F07IR1F1061 Irradiated Medicago truncatula cDNA clone
NF019F07IR 5', mRNA sequence
Length = 540
Score = 44.1 bits (22), Expect = 0.020
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||||||||| | || ||||||||||
Sbjct: 169 tggcaggatggcttaggtgactggggcgtcatccagaaccatagagcggtcttgaagg 112
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 157,428
Number of Sequences: 392609
Number of extensions: 157428
Number of successful extensions: 12459
Number of sequences better than 0.5: 68
Number of HSP's better than 0.5 without gapping: 68
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12335
Number of HSP's gapped (non-prelim): 124
length of query: 908
length of database: 441,732,993
effective HSP length: 20
effective length of query: 888
effective length of database: 433,880,813
effective search space: 385286161944
effective search space used: 385286161944
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)