BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.288
(1775 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL366474.1|AL366474 MtBA08B10R1 MtBA Medicago truncatula... 123 5e-026
gb|AL367921.1|AL367921 MtBA21B04R1 MtBA Medicago truncatula... 123 5e-026
gb|AL369659.1|AL369659 MtBA32E02R1 MtBA Medicago truncatula... 123 5e-026
gb|CB892640.1|CB892640 EST645432 HOGA Medicago truncatula c... 123 5e-026
gb|CA920649.1|CA920649 EST638367 MTUS Medicago truncatula c... 123 5e-026
gb|BQ123969.1|BQ123969 EST609545 GLSD Medicago truncatula c... 113 5e-023
gb|AL373654.1|AL373654 MtBB02A09F3 MtBB Medicago truncatula... 105 1e-020
gb|BQ123510.1|BQ123510 EST609086 GLSD Medicago truncatula c... 98 3e-018
gb|AL388927.1|AL388927 MtBC51F06R2 MtBC Medicago truncatula... 96 1e-017
gb|AL382618.1|AL382618 MtBC09A02R1 MtBC Medicago truncatula... 76 1e-011
gb|CA917138.1|CA917138 EST641285 GPOD Medicago truncatula c... 76 1e-011
gb|CG941610.1|CG941610 MBEGL75TFB mth2 Medicago truncatula ... 74 5e-011
gb|BG644390.1|BG644390 EST506009 KV3 Medicago truncatula cD... 62 2e-007
gb|AL382563.1|AL382563 MtBC08C05F1 MtBC Medicago truncatula... 52 2e-004
gb|BQ123432.1|BQ123432 EST609008 GLSD Medicago truncatula c... 52 2e-004
gb|AW559410.1|AW559410 EST314458 DSIR Medicago truncatula c... 46 0.010
gb|AL382617.1|AL382617 MtBC09A02F1 MtBC Medicago truncatula... 46 0.010
gb|BF519814.1|BF519814 EST457278 DSIL Medicago truncatula c... 46 0.010
gb|BF520583.1|BF520583 EST458056 DSIL Medicago truncatula c... 46 0.010
gb|AW691102.2|AW691102 NF041C06ST1F1000 Developing stem Med... 46 0.010
gb|BI270015.1|BI270015 NF003C03FL1F1022 Developing flower M... 46 0.010
gb|DW018880.1|DW018880 EST1227841 MTY Medicago truncatula c... 46 0.010
gb|AJ503301.1|AJ503301 AJ503301 MTAMP Medicago truncatula c... 44 0.040
gb|BI310809.1|BI310809 EST5312559 GESD Medicago truncatula ... 42 0.16
gb|BI311087.1|BI311087 EST5312837 GESD Medicago truncatula ... 42 0.16
emb|CR954196.1| Medicago truncatula chromosome 5 clone mth2... 42 0.16
>gb|AL366474.1|AL366474 MtBA08B10R1 MtBA Medicago truncatula cDNA clone MtBA08B10 T7, mRNA
sequence
Length = 503
Score = 123 bits (62), Expect = 5e-026
Identities = 221/274 (80%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctg 1080
||||||||||||||||||| ||||| ||||| || |||| ||| | || ||||| ||||
Sbjct: 4 tggaatactctgttgagatttatgagtggtctgggacaacatgggaaccttatgtagctg 63
Query: 1081 atgatgtgcagcttcaatttttcatgatgagcccttacgttctgaaaactatgtcgactg 1140
||||||| || ||||||||| |||||||||||| || || |||| ||| | || | ||
Sbjct: 64 atgatgttcaagttcaattttacatgatgagcccctatgtcttgaagactttatcaaatg 123
Query: 1141 acaacaagggtttgtattcaacaaccttcaaagttccagatgtttatggagttttccagt 1200
||||||||||| |||| ||| | || || ||||||||||| ||||| ||||||||||
Sbjct: 124 acaacaagggtcgttatttcacatcgtttaaggttccagatgtctatggggttttccagt 183
Query: 1201 tcaaagttgagtaccaaagactgggatatactggtctgtcttttacaaagcagattccag 1260
||||||| ||||| | ||||| |||||||| | | ||||| ||||||||||||| |
Sbjct: 184 tcaaagtggagtatgatagacttggatatacaagcttatctttagcaaagcagattcctg 243
Query: 1261 tacgtccttacagacataatgagtatgagagatt 1294
| ||||||| || ||| ||||| || ||||||||
Sbjct: 244 tccgtcctttcaaacacaatgaatacgagagatt 277
>gb|AL367921.1|AL367921 MtBA21B04R1 MtBA Medicago truncatula cDNA clone MtBA21B04 T7, mRNA
sequence
Length = 558
Score = 123 bits (62), Expect = 5e-026
Identities = 221/274 (80%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctg 1080
||||||||||||||||||| ||||| ||||| || |||| ||| | || ||||| ||||
Sbjct: 32 tggaatactctgttgagatttatgagtggtctgggacaacatgggaaccttatgtagctg 91
Query: 1081 atgatgtgcagcttcaatttttcatgatgagcccttacgttctgaaaactatgtcgactg 1140
||||||| || ||||||||| |||||||||||| || || |||| ||| | || | ||
Sbjct: 92 atgatgttcaagttcaattttacatgatgagcccctatgtcttgaagactttatcaaatg 151
Query: 1141 acaacaagggtttgtattcaacaaccttcaaagttccagatgtttatggagttttccagt 1200
||||||||||| |||| ||| | || || ||||||||||| ||||| ||||||||||
Sbjct: 152 acaacaagggtcgttatttcacatcgtttaaggttccagatgtctatggggttttccagt 211
Query: 1201 tcaaagttgagtaccaaagactgggatatactggtctgtcttttacaaagcagattccag 1260
||||||| ||||| | ||||| |||||||| | | ||||| ||||||||||||| |
Sbjct: 212 tcaaagtggagtatgatagacttggatatacaagcttatctttagcaaagcagattcctg 271
Query: 1261 tacgtccttacagacataatgagtatgagagatt 1294
| ||||||| || ||| ||||| || ||||||||
Sbjct: 272 tccgtcctttcaaacacaatgaatacgagagatt 305
>gb|AL369659.1|AL369659 MtBA32E02R1 MtBA Medicago truncatula cDNA clone MtBA32E02 T7, mRNA
sequence
Length = 523
Score = 123 bits (62), Expect = 5e-026
Identities = 221/274 (80%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctg 1080
||||||||||||||||||| ||||| ||||| || |||| ||| | || ||||| ||||
Sbjct: 16 tggaatactctgttgagatttatgagtggtctgggacaacatgggaaccttatgtagctg 75
Query: 1081 atgatgtgcagcttcaatttttcatgatgagcccttacgttctgaaaactatgtcgactg 1140
||||||| || ||||||||| |||||||||||| || || |||| ||| | || | ||
Sbjct: 76 atgatgttcaagttcaattttacatgatgagcccctatgtcttgaagactttatcaaatg 135
Query: 1141 acaacaagggtttgtattcaacaaccttcaaagttccagatgtttatggagttttccagt 1200
||||||||||| |||| ||| | || || ||||||||||| ||||| ||||||||||
Sbjct: 136 acaacaagggtcgttatttcacatcgtttaaggttccagatgtctatggggttttccagt 195
Query: 1201 tcaaagttgagtaccaaagactgggatatactggtctgtcttttacaaagcagattccag 1260
||||||| ||||| | ||||| |||||||| | | ||||| ||||||||||||| |
Sbjct: 196 tcaaagtggagtatgatagacttggatatacaagcttatctttagcaaagcagattcctg 255
Query: 1261 tacgtccttacagacataatgagtatgagagatt 1294
| ||||||| || ||| ||||| || ||||||||
Sbjct: 256 tccgtcctttcaaacacaatgaatacgagagatt 289
>gb|CB892640.1|CB892640 EST645432 HOGA Medicago truncatula cDNA clone HOGA-19G16, mRNA
sequence
Length = 758
Score = 123 bits (62), Expect = 5e-026
Identities = 221/274 (80%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctg 1080
||||||||||||||||||| ||||| ||||| || |||| ||| | || ||||| ||||
Sbjct: 390 tggaatactctgttgagatttatgagtggtctgggacaacatgggaaccttatgtagctg 449
Query: 1081 atgatgtgcagcttcaatttttcatgatgagcccttacgttctgaaaactatgtcgactg 1140
||||||| || ||||||||| |||||||||||| || || |||| ||| | || | ||
Sbjct: 450 atgatgttcaagttcaattttacatgatgagcccctatgtcttgaagactttatcaaatg 509
Query: 1141 acaacaagggtttgtattcaacaaccttcaaagttccagatgtttatggagttttccagt 1200
||||||||||| |||| ||| | || || ||||||||||| ||||| ||||||||||
Sbjct: 510 acaacaagggtcgttatttcacatcgtttaaggttccagatgtctatggggttttccagt 569
Query: 1201 tcaaagttgagtaccaaagactgggatatactggtctgtcttttacaaagcagattccag 1260
||||||| ||||| | ||||| |||||||| | | ||||| ||||||||||||| |
Sbjct: 570 tcaaagtggagtatgatagacttggatatacaagcttatctttagcaaagcagattcctg 629
Query: 1261 tacgtccttacagacataatgagtatgagagatt 1294
| ||||||| || ||| ||||| || ||||||||
Sbjct: 630 tccgtcctttcaaacacaatgaatacgagagatt 663
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 125 tcattagtttcagttatacaggcgagaaataatgctcgg 163
>gb|CA920649.1|CA920649 EST638367 MTUS Medicago truncatula cDNA clone MTUS-30F11, mRNA
sequence
Length = 821
Score = 123 bits (62), Expect = 5e-026
Identities = 221/274 (80%)
Strand = Plus / Minus
Query: 1021 tggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctg 1080
||||||||||||||||||| ||||| ||||| || |||| ||| | || ||||| ||||
Sbjct: 452 tggaatactctgttgagatttatgagtggtctgggacaacatgggaaccttatgtagctg 393
Query: 1081 atgatgtgcagcttcaatttttcatgatgagcccttacgttctgaaaactatgtcgactg 1140
||||||| || ||||||||| |||||||||||| || || |||| ||| | || | ||
Sbjct: 392 atgatgttcaagttcaattttacatgatgagcccctatgtcttgaagactttatcaaatg 333
Query: 1141 acaacaagggtttgtattcaacaaccttcaaagttccagatgtttatggagttttccagt 1200
||||||||||| |||| ||| | || || ||||||||||| ||||| ||||||||||
Sbjct: 332 acaacaagggtcgttatttcacatcgtttaaggttccagatgtctatggggttttccagt 273
Query: 1201 tcaaagttgagtaccaaagactgggatatactggtctgtcttttacaaagcagattccag 1260
||||||| ||||| | ||||| |||||||| | | ||||| ||||||||||||| |
Sbjct: 272 tcaaagtggagtatgatagacttggatatacaagcttatctttagcaaagcagattcctg 213
Query: 1261 tacgtccttacagacataatgagtatgagagatt 1294
| ||||||| || ||| ||||| || ||||||||
Sbjct: 212 tccgtcctttcaaacacaatgaatacgagagatt 179
>gb|BQ123969.1|BQ123969 EST609545 GLSD Medicago truncatula cDNA clone pGLSD-33N24, mRNA
sequence
Length = 690
Score = 113 bits (57), Expect = 5e-023
Identities = 201/249 (80%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctg 1080
||||||||||||||||||| ||||| ||||| || |||| ||| | || ||||| ||||
Sbjct: 432 tggaatactctgttgagatttatgagtggtctgggacaacatgggaaccttatgtagctg 491
Query: 1081 atgatgtgcagcttcaatttttcatgatgagcccttacgttctgaaaactatgtcgactg 1140
||||||| || ||||||||| |||||||||||| || || |||| ||| | || | ||
Sbjct: 492 atgatgttcaagttcaattttacatgatgagcccctatgtcttgaagactttatcaaatg 551
Query: 1141 acaacaagggtttgtattcaacaaccttcaaagttccagatgtttatggagttttccagt 1200
||||||||||| |||| ||| | || || ||||||||||| ||||| ||||||||||
Sbjct: 552 acaacaagggtcgttatttcacatcgtttaaggttccagatgtctatggggttttccagt 611
Query: 1201 tcaaagttgagtaccaaagactgggatatactggtctgtcttttacaaagcagattccag 1260
||||||| ||||| | ||||| |||||||| | | ||||| ||||||||||||| |
Sbjct: 612 tcaaagtggagtatgatagacttggatatacaagcttatctttagcaaagcagattcctg 671
Query: 1261 tacgtcctt 1269
| |||||||
Sbjct: 672 tccgtcctt 680
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 167 tcattagtttcagttatacaggcgagaaataatgctcgg 205
>gb|AL373654.1|AL373654 MtBB02A09F3 MtBB Medicago truncatula cDNA clone MtBB02A09 T3, mRNA
sequence
Length = 465
Score = 105 bits (53), Expect = 1e-020
Identities = 158/193 (81%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctg 1080
||||||||||||||||||| ||||| ||||| || |||| ||| | || ||||| ||||
Sbjct: 260 tggaatactctgttgagatttatgagtggtctgggacaacatgggaaccttatgtagctg 319
Query: 1081 atgatgtgcagcttcaatttttcatgatgagcccttacgttctgaaaactatgtcgactg 1140
||||||| || ||||||||| |||||||||||| || || |||| ||| | || | ||
Sbjct: 320 atgatgttcaagttcaattttacatgatgagcccctatgtcttgaagactttatcaaatg 379
Query: 1141 acaacaagggtttgtattcaacaaccttcaaagttccagatgtttatggagttttccagt 1200
||||||||||| |||| ||| | || || ||||||||||| ||||| ||||||||||
Sbjct: 380 acaacaagggtcgttatttcacatcgtttaaggttccagatgtctatggggttttccagt 439
Query: 1201 tcaaagttgagta 1213
||||||| |||||
Sbjct: 440 tcaaagtggagta 452
Score = 42.1 bits (21), Expect = 0.16
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 762 gtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| |||||||||||||||
Sbjct: 1 gtttcagttatacaggcgagaaataatgctcgg 33
>gb|BQ123510.1|BQ123510 EST609086 GLSD Medicago truncatula cDNA clone pGLSD-32D17, mRNA
sequence
Length = 763
Score = 97.6 bits (49), Expect = 3e-018
Identities = 199/249 (79%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctg 1080
||||||||||||||||||| ||||| ||||| || |||| ||| | || ||||| ||||
Sbjct: 468 tggaatactctgttgagatttatgagtggtctgggacaacatgggaaccttatgtagctg 527
Query: 1081 atgatgtgcagcttcaatttttcatgatgagcccttacgttctgaaaactatgtcgactg 1140
||||||| || ||||||||| |||||||||||| || || |||| ||| | || | ||
Sbjct: 528 atgatgttcaagttcaattttacatgatgagcccctatgtcttgaagactttatcaaatg 587
Query: 1141 acaacaagggtttgtattcaacaaccttcaaagttccagatgtttatggagttttccagt 1200
||||||||||| |||| ||| | || || ||||||||||| ||||| ||||||||||
Sbjct: 588 acaacaagggtcgttatttcacatcgtttaaggttccagatgtctatggggttttccagt 647
Query: 1201 tcaaagttgagtaccaaagactgggatatactggtctgtcttttacaaagcagattccag 1260
| |||| ||||| | ||||| |||||||| | | ||||| |||||||||| ||| |
Sbjct: 648 ttcaagtggagtatgatagacttggatatacaagcttatctttaacaaagcagaatcctg 707
Query: 1261 tacgtcctt 1269
| |||||||
Sbjct: 708 tccgtcctt 716
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 203 tcattagtttcagttatacaggcgagaaataatgctcgg 241
>gb|AL388927.1|AL388927 MtBC51F06R2 MtBC Medicago truncatula cDNA clone MtBC51F06 T7, mRNA
sequence
Length = 551
Score = 95.6 bits (48), Expect = 1e-017
Identities = 180/224 (80%)
Strand = Plus / Plus
Query: 1071 tatgttgctgatgatgtgcagcttcaatttttcatgatgagcccttacgttctgaaaact 1130
||||| ||||||||||| || ||||||||| |||||||||||| || || |||| |||
Sbjct: 25 tatgtagctgatgatgttcaagttcaattttacatgatgagcccctatgtcttgaagact 84
Query: 1131 atgtcgactgacaacaagggtttgtattcaacaaccttcaaagttccagatgtttatgga 1190
| || | ||||||||||||| |||| ||| | || || ||||||||||| |||||
Sbjct: 85 ttatcaaatgacaacaagggtcgttatttcacatcgtttaaggttccagatgtctatggg 144
Query: 1191 gttttccagttcaaagttgagtaccaaagactgggatatactggtctgtcttttacaaag 1250
||||||||||||||||| ||||| | ||||| |||||||| | | ||||| |||||
Sbjct: 145 gttttccagttcaaagtggagtatgatagacttggatatacaagcttatctttagcaaag 204
Query: 1251 cagattccagtacgtccttacagacataatgagtatgagagatt 1294
|||||||| || ||||||| || ||| ||||| || ||||||||
Sbjct: 205 cagattcctgtccgtcctttcaaacacaatgaatacgagagatt 248
>gb|AL382618.1|AL382618 MtBC09A02R1 MtBC Medicago truncatula cDNA clone MtBC09A02 T7, mRNA
sequence
Length = 409
Score = 75.8 bits (38), Expect = 1e-011
Identities = 101/122 (82%)
Strand = Plus / Plus
Query: 1173 gttccagatgtttatggagttttccagttcaaagttgagtaccaaagactgggatatact 1232
||||||||||| ||||| ||||||||||||||||| ||||| | ||||| ||||||||
Sbjct: 17 gttccagatgtctatggggttttccagttcaaagtggagtatgatagacttggatataca 76
Query: 1233 ggtctgtcttttacaaagcagattccagtacgtccttacagacataatgagtatgagaga 1292
| | ||||| ||||||||||||| || ||||||| || ||| ||||| || ||||||
Sbjct: 77 agcttatctttagcaaagcagattcctgtccgtcctttcaaacacaatgaatacgagaga 136
Query: 1293 tt 1294
||
Sbjct: 137 tt 138
>gb|CA917138.1|CA917138 EST641285 GPOD Medicago truncatula cDNA clone GPOD-35C4, mRNA
sequence
Length = 733
Score = 75.8 bits (38), Expect = 1e-011
Identities = 80/94 (85%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctg 1080
||||||||||||||||||| ||||| ||||| || |||| ||| | || ||||| ||||
Sbjct: 609 tggaatactctgttgagatttatgagtggtctgggacaacatgggaaccttatgtagctg 668
Query: 1081 atgatgtgcagcttcaatttttcatgatgagccc 1114
||||||| || ||||||||| ||||||||||||
Sbjct: 669 atgatgttcaagttcaattttacatgatgagccc 702
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 344 tcattagtttcagttatacaggcgagaaataatgctcgg 382
>gb|CG941610.1|CG941610 MBEGL75TFB mth2 Medicago truncatula genomic clone 50N6, DNA sequence
Length = 923
Score = 73.8 bits (37), Expect = 5e-011
Identities = 79/93 (84%)
Strand = Plus / Minus
Query: 1022 ggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctga 1081
|||||||||||||||||| ||||| ||||| || |||| ||| | || ||||| |||||
Sbjct: 304 ggaatactctgttgagatttatgagtggtctgggacaacatgggaaccttatgtagctga 245
Query: 1082 tgatgtgcagcttcaatttttcatgatgagccc 1114
|||||| || ||||||||| ||||||||||||
Sbjct: 244 tgatgttcaagttcaattttacatgatgagccc 212
Score = 61.9 bits (31), Expect = 2e-007
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 1173 gttccagatgtttatggagttttccagttcaaagttgagtaccaaagactgggatatac 1231
||||||||||| ||||| ||||||||||||||||| ||||| | ||||| ||||||||
Sbjct: 64 gttccagatgtctatggggttttccagttcaaagtggagtatgatagacttggatatac 6
>gb|BG644390.1|BG644390 EST506009 KV3 Medicago truncatula cDNA clone pKV3-37K17 5' end,
mRNA sequence
Length = 689
Score = 61.9 bits (31), Expect = 2e-007
Identities = 79/95 (83%)
Strand = Plus / Plus
Query: 388 ttgatgctgggcatgacatgatcctggcggcagattcctctgcctctgatctcattcgtg 447
||||| |||| ||||| ||||||| ||||| ||| | ||||| |||||||| ||| | |
Sbjct: 393 ttgattctggccatgatttgatccttgcggctgatgcatctgcatctgatctaattagag 452
Query: 448 gcattgcaacagagtgtggggttgattttgatgag 482
||||| || ||||||||||||||||||||||||
Sbjct: 453 agattgctactgagtgtggggttgattttgatgag 487
>gb|AL382563.1|AL382563 MtBC08C05F1 MtBC Medicago truncatula cDNA clone MtBC08C05 T3, mRNA
sequence
Length = 371
Score = 52.0 bits (26), Expect = 2e-004
Identities = 83/102 (81%)
Strand = Plus / Minus
Query: 1193 tttccagttcaaagttgagtaccaaagactgggatatactggtctgtcttttacaaagca 1252
||||||||||||||| ||||| | ||||| |||||||| | | ||||| |||||||
Sbjct: 371 tttccagttcaaagtggagtatgatagacttggatatacaagcttatctttagcaaagca 312
Query: 1253 gattccagtacgtccttacagacataatgagtatgagagatt 1294
|||||| || ||||||| || ||| ||||| || ||||||||
Sbjct: 311 gattcctgtccgtcctttcaaacacaatgaatacgagagatt 270
>gb|BQ123432.1|BQ123432 EST609008 GLSD Medicago truncatula cDNA clone pGLSD-32O11, mRNA
sequence
Length = 430
Score = 52.0 bits (26), Expect = 2e-004
Identities = 79/94 (84%), Gaps = 2/94 (2%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtccggaacaagctggaagccgtatgttgctg 1080
||||||||||||||||||| ||||| ||| | || |||| ||| | || ||||| ||||
Sbjct: 322 tggaatactctgttgagatttatgagtgggctgggacaacatgggaaccctatgtagctg 381
Query: 1081 atgatgtgcagcttcaatttttcatgatgagccc 1114
||||||| ||| ||||| ||| ||||||||||||
Sbjct: 382 atgatgttcag-ttcaa-tttacatgatgagccc 413
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 57 tcattagtttcagttatacaggcgagaaataatgctcgg 95
>gb|AW559410.1|AW559410 EST314458 DSIR Medicago truncatula cDNA clone pDSIR-19A17, mRNA
sequence
Length = 806
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 593 tcattagtttcagttatacaggcgagaaataatgctcgg 631
>gb|AL382617.1|AL382617 MtBC09A02F1 MtBC Medicago truncatula cDNA clone MtBC09A02 T3, mRNA
sequence
Length = 441
Score = 46.1 bits (23), Expect = 0.010
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtc 1051
||||||||||||||||||| ||||| |||||
Sbjct: 394 tggaatactctgttgagatttatgagtggtc 424
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 129 tcattagtttcagttatacaggcgagaaataatgctcgg 167
>gb|BF519814.1|BF519814 EST457278 DSIL Medicago truncatula cDNA clone pDSIL-21D12, mRNA
sequence
Length = 625
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 516 tcattagtttcagttatacaggcgagaaataatgctcgg 554
>gb|BF520583.1|BF520583 EST458056 DSIL Medicago truncatula cDNA clone pDSIL-24F10, mRNA
sequence
Length = 623
Score = 46.1 bits (23), Expect = 0.010
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtc 1051
||||||||||||||||||| ||||| |||||
Sbjct: 572 tggaatactctgttgagatttatgagtggtc 602
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 307 tcattagtttcagttatacaggcgagaaataatgctcgg 345
>gb|AW691102.2|AW691102 NF041C06ST1F1000 Developing stem Medicago truncatula cDNA clone
NF041C06ST 5', mRNA sequence
Length = 575
Score = 46.1 bits (23), Expect = 0.010
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 1021 tggaatactctgttgagatctatgaatggtc 1051
||||||||||||||||||| ||||| |||||
Sbjct: 455 tggaatactctgttgagatttatgagtggtc 485
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 190 tcattagtttcagttatacaggcgagaaataatgctcgg 228
>gb|BI270015.1|BI270015 NF003C03FL1F1022 Developing flower Medicago truncatula cDNA clone
NF003C03FL 5', mRNA sequence
Length = 645
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 361 tcattagtttcagttatacaggcgagaaataatgctcgg 399
>gb|DW018880.1|DW018880 EST1227841 MTY Medicago truncatula cDNA clone MTYBC05, mRNA
sequence
Length = 760
Score = 46.1 bits (23), Expect = 0.010
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 756 tcattggtttcggttatgcaggcaagaaataatgctcgg 794
||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 715 tcattagtttcagttatacaggcgagaaataatgctcgg 753
>gb|AJ503301.1|AJ503301 AJ503301 MTAMP Medicago truncatula cDNA clone mtgmadc120032e03,
mRNA sequence
Length = 278
Score = 44.1 bits (22), Expect = 0.040
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 19 actccaaacccaacccaaaacc 40
||||||||||||||||||||||
Sbjct: 95 actccaaacccaacccaaaacc 116
>gb|BI310809.1|BI310809 EST5312559 GESD Medicago truncatula cDNA clone pGESD9I19 5' end, mRNA
sequence
Length = 325
Score = 42.1 bits (21), Expect = 0.16
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 1246 caaagcagattccagtacgtccttacagacataatgagtatgagagatt 1294
||||||||||||| || ||||||| || ||| ||||| || ||||||||
Sbjct: 48 caaagcagattcctgtccgtcctttcaaacacaatgaatacgagagatt 96
>gb|BI311087.1|BI311087 EST5312837 GESD Medicago truncatula cDNA clone pGESD9L14 5' end, mRNA
sequence
Length = 326
Score = 42.1 bits (21), Expect = 0.16
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 1246 caaagcagattccagtacgtccttacagacataatgagtatgagagatt 1294
||||||||||||| || ||||||| || ||| ||||| || ||||||||
Sbjct: 49 caaagcagattcctgtccgtcctttcaaacacaatgaatacgagagatt 97
>emb|CR954196.1| Medicago truncatula chromosome 5 clone mth2-157e5, COMPLETE SEQUENCE
Length = 132419
Score = 42.1 bits (21), Expect = 0.16
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 864 agcaaaacaagatatgagaga 884
|||||||||||||||||||||
Sbjct: 53151 agcaaaacaagatatgagaga 53171
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 359,684
Number of Sequences: 392609
Number of extensions: 359684
Number of successful extensions: 26493
Number of sequences better than 0.5: 26
Number of HSP's better than 0.5 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26390
Number of HSP's gapped (non-prelim): 76
length of query: 1775
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1755
effective length of database: 433,880,813
effective search space: 761460826815
effective search space used: 761460826815
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)