BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 129373.2.1
(1297 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BG646569.1|BG646569 EST508188 HOGA Medicago truncatula c... 42 0.12
gb|AJ501998.1|AJ501998 AJ501998 MTAMP Medicago truncatula c... 42 0.12
gb|CA920441.1|CA920441 EST638159 MTUS Medicago truncatula c... 42 0.12
emb|CR323139.1| mte1-5F14FM1 BAC end, cultivar Jemalong A17... 40 0.46
emb|CR324382.1| mte1-51D7FM1 BAC end, cultivar Jemalong A17... 40 0.46
gb|AC144721.18| Medicago truncatula clone mth2-11o23, compl... 40 0.46
>gb|BG646569.1|BG646569 EST508188 HOGA Medicago truncatula cDNA clone pHOGA-9M11 5' end,
mRNA sequence
Length = 794
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 490 cctttgctttcttatcagaaa 510
|||||||||||||||||||||
Sbjct: 473 cctttgctttcttatcagaaa 453
>gb|AJ501998.1|AJ501998 AJ501998 MTAMP Medicago truncatula cDNA clone mtgmadc120014c12,
mRNA sequence
Length = 713
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 490 cctttgctttcttatcagaaa 510
|||||||||||||||||||||
Sbjct: 397 cctttgctttcttatcagaaa 377
>gb|CA920441.1|CA920441 EST638159 MTUS Medicago truncatula cDNA clone MTUS-28C8, mRNA
sequence
Length = 616
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 490 cctttgctttcttatcagaaa 510
|||||||||||||||||||||
Sbjct: 508 cctttgctttcttatcagaaa 528
>emb|CR323139.1| mte1-5F14FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 686
Score = 40.1 bits (20), Expect = 0.46
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 909 accttgtaaccagagaaaaa 928
||||||||||||||||||||
Sbjct: 147 accttgtaaccagagaaaaa 128
>emb|CR324382.1| mte1-51D7FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 708
Score = 40.1 bits (20), Expect = 0.46
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 909 accttgtaaccagagaaaaa 928
||||||||||||||||||||
Sbjct: 146 accttgtaaccagagaaaaa 127
>gb|AC144721.18| Medicago truncatula clone mth2-11o23, complete sequence
Length = 135959
Score = 40.1 bits (20), Expect = 0.46
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1054 catacattaaggcactgtcacttt 1077
|||||||||| |||||||||||||
Sbjct: 33881 catacattaaagcactgtcacttt 33858
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 345,452
Number of Sequences: 392609
Number of extensions: 345452
Number of successful extensions: 26430
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26418
Number of HSP's gapped (non-prelim): 12
length of query: 1297
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1277
effective length of database: 433,880,813
effective search space: 554065798201
effective search space used: 554065798201
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)