BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCM3d10.yg.2.1
(683 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF322116.2|AF322116 Medicago sativa sucrose-phosphate sy... 76 4e-014
gb|AY468362.2| Medicago sativa sucrose-phosphate synthase g... 76 4e-014
gb|CO512526.1|CO512526 s13dSG08B0800061_120978 Glandular tr... 34 0.12
gb|CO516018.1|CO516018 s13dSG64A0200005_445364 Glandular tr... 32 0.49
gb|CO516970.1|CO516970 s13dSG81C0400022_468486 Glandular tr... 32 0.49
>gb|AF322116.2|AF322116 Medicago sativa sucrose-phosphate synthase mRNA, complete cds
Length = 3579
Score = 75.8 bits (38), Expect = 4e-014
Identities = 116/142 (81%)
Strand = Plus / Plus
Query: 373 attgatgaaatgtcaagcacaaatgcagctgttttgacttcagcactcaagttaattgat 432
|||||||||||||||||||||| | | ||||| | |||| ||||||||| |||||
Sbjct: 1697 attgatgaaatgtcaagcacaagttcttctgttcttctctcagtactcaagttgattgac 1756
Query: 433 aaatatgatctatatggacaagtggcataccccaagcaccataagcaatctgaagttcct 492
|| || ||||| ||||| ||||||||||| || || ||||| || |||||||| ||||||
Sbjct: 1757 aagtacgatctgtatgggcaagtggcatatcctaaacaccacaaacaatctgatgttcct 1816
Query: 493 gatatttatcgtttagctgcga 514
|| || |||||| |||| ||||
Sbjct: 1817 gaaatatatcgtctagcagcga 1838
Score = 63.9 bits (32), Expect = 1e-010
Identities = 98/120 (81%)
Strand = Plus / Plus
Query: 192 agatccacctatttgggctgatataatgcgcttcttctcaaacccccggaagccaatgat 251
|||||| ||||||||| |||| |||||||| ||||| | ||||| || ||||| ||||
Sbjct: 1516 agatccgcctatttggtctgagataatgcggttctttaccaaccctcgcaagcctgtgat 1575
Query: 252 tcttgctcttgctcgtccggatccgaagaagaatatcactactctagtcaaagcatttgg 311
||||||||||| | || ||||| |||||||| ||||| ||| | || |||||||||||
Sbjct: 1576 acttgctcttgccagaccagatcctaagaagaacatcacaactttggtgaaagcatttgg 1635
>gb|AY468362.2| Medicago sativa sucrose-phosphate synthase gene, promoter region and
complete cds
Length = 8933
Score = 75.8 bits (38), Expect = 4e-014
Identities = 116/142 (81%)
Strand = Plus / Plus
Query: 373 attgatgaaatgtcaagcacaaatgcagctgttttgacttcagcactcaagttaattgat 432
|||||||||||||||||||||| | | ||||| | |||| ||||||||| |||||
Sbjct: 5400 attgatgaaatgtcaagcacaagttcttctgttcttctctcagtactcaagttgattgac 5459
Query: 433 aaatatgatctatatggacaagtggcataccccaagcaccataagcaatctgaagttcct 492
|| || ||||| ||||| ||||||||||| || || ||||| || |||||||| ||||||
Sbjct: 5460 aagtacgatctgtatgggcaagtggcatatcctaaacaccacaaacaatctgatgttcct 5519
Query: 493 gatatttatcgtttagctgcga 514
|| || |||||| |||| ||||
Sbjct: 5520 gaaatatatcgtctagcagcga 5541
Score = 44.1 bits (22), Expect = 1e-004
Identities = 79/98 (80%)
Strand = Plus / Plus
Query: 214 ataatgcgcttcttctcaaacccccggaagccaatgattcttgctcttgctcgtccggat 273
|||||||| ||||| | ||||| || ||||| |||| ||||||||||| | || |||
Sbjct: 5123 ataatgcggttctttaccaaccctcgcaagcctgtgatacttgctcttgccagaccagat 5182
Query: 274 ccgaagaagaatatcactactctagtcaaagcatttgg 311
|| |||||||| ||||| ||| | || |||||||||||
Sbjct: 5183 cctaagaagaacatcacaactttggtgaaagcatttgg 5220
Score = 34.2 bits (17), Expect = 0.12
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 192 agatccacctatttgggctga 212
|||||||||||||||| ||||
Sbjct: 4938 agatccacctatttggtctga 4958
>gb|CO512526.1|CO512526 s13dSG08B0800061_120978 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 611
Score = 34.2 bits (17), Expect = 0.12
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 476 agcaatctgaagttcct 492
|||||||||||||||||
Sbjct: 167 agcaatctgaagttcct 151
>gb|CO516018.1|CO516018 s13dSG64A0200005_445364 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 500
Score = 32.2 bits (16), Expect = 0.49
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 367 gatgtcattgatgaaa 382
||||||||||||||||
Sbjct: 370 gatgtcattgatgaaa 355
>gb|CO516970.1|CO516970 s13dSG81C0400022_468486 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 370
Score = 32.2 bits (16), Expect = 0.49
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 478 caatctgaagttcctg 493
||||||||||||||||
Sbjct: 142 caatctgaagttcctg 127
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1433
Number of Sequences: 7669
Number of extensions: 1433
Number of successful extensions: 474
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 462
Number of HSP's gapped (non-prelim): 12
length of query: 683
length of database: 3,745,706
effective HSP length: 16
effective length of query: 667
effective length of database: 3,623,002
effective search space: 2416542334
effective search space used: 2416542334
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)