BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCF2e06.yg.2.1
(319 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF049487.1|AF049487 Medicago sativa sucrose synthase mRN... 44 6e-005
>gb|AF049487.1|AF049487 Medicago sativa sucrose synthase mRNA, complete cds
Length = 2760
Score = 44.1 bits (22), Expect = 6e-005
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 235 gtcactcagtgtaccatcgctcatgc 260
||||||||||||||||| ||||||||
Sbjct: 1346 gtcactcagtgtaccattgctcatgc 1371
Score = 34.2 bits (17), Expect = 0.056
Identities = 29/33 (87%)
Strand = Plus / Plus
Query: 100 tggccatacctggagacatacactgaggatgtt 132
|||||||| || || || |||||||||||||||
Sbjct: 1211 tggccatatctagaaacttacactgaggatgtt 1243
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 493
Number of Sequences: 7669
Number of extensions: 493
Number of successful extensions: 134
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 132
Number of HSP's gapped (non-prelim): 2
length of query: 319
length of database: 3,745,706
effective HSP length: 15
effective length of query: 304
effective length of database: 3,630,671
effective search space: 1103723984
effective search space used: 1103723984
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)