BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= MAD56_a5f4.3.2
(1520 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF056621.1|AF056621 Medicago sativa putative Cu/Zn super... 34 0.28
gb|AF417491.1| Medicago sativa RING-H2 protein (RH2-1) gene... 34 0.28
>gb|AF056621.1|AF056621 Medicago sativa putative Cu/Zn superoxide dismutase precursor,
mRNA, nuclear gene encoding chloroplast protein,
complete cds
Length = 900
Score = 34.2 bits (17), Expect = 0.28
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 48 cttggcagcagcaacaa 64
|||||||||||||||||
Sbjct: 206 cttggcagcagcaacaa 190
>gb|AF417491.1| Medicago sativa RING-H2 protein (RH2-1) gene, complete cds
Length = 3970
Score = 34.2 bits (17), Expect = 0.28
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1279 atgatgatgatgatataaata 1299
|||||||||||||||| ||||
Sbjct: 1788 atgatgatgatgatatgaata 1768
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2788
Number of Sequences: 7669
Number of extensions: 2788
Number of successful extensions: 858
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 854
Number of HSP's gapped (non-prelim): 4
length of query: 1520
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1504
effective length of database: 3,623,002
effective search space: 5448995008
effective search space used: 5448995008
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)