BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= MAD56_a5f4.3.2
         (1520 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AF056621.1|AF056621  Medicago sativa putative Cu/Zn super...    34   0.28 
gb|AF417491.1|  Medicago sativa RING-H2 protein (RH2-1) gene...    34   0.28 
>gb|AF056621.1|AF056621 Medicago sativa putative Cu/Zn superoxide dismutase precursor,
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 900

 Score = 34.2 bits (17), Expect = 0.28
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 48  cttggcagcagcaacaa 64
           |||||||||||||||||
Sbjct: 206 cttggcagcagcaacaa 190
>gb|AF417491.1| Medicago sativa RING-H2 protein (RH2-1) gene, complete cds
          Length = 3970

 Score = 34.2 bits (17), Expect = 0.28
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1279 atgatgatgatgatataaata 1299
            |||||||||||||||| ||||
Sbjct: 1788 atgatgatgatgatatgaata 1768
  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2788
Number of Sequences: 7669
Number of extensions: 2788
Number of successful extensions: 858
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 854
Number of HSP's gapped (non-prelim): 4
length of query: 1520
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1504
effective length of database: 3,623,002
effective search space: 5448995008
effective search space used: 5448995008
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)