BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= F5H
(1360 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|Z50800.1|MSASET2MR M.sativa mRNA for ASET2 96 8e-020
gb|AJ410110.1|AJ410110 AJ410110 Medicago sativa library (Ka... 82 1e-015
gb|DQ222912.1| Medicago sativa ferulate 5-hydroxylase (F5H-... 52 1e-006
gb|DQ222911.1| Medicago sativa ferulate 5-hydroxylase (F5H-... 46 7e-005
gb|CO513719.1|CO513719 s13dSG15C1000070_140220 Glandular tr... 30 3.9
gb|CO514116.1|CO514116 s13dSG75E0100003_156894 Glandular tr... 30 3.9
gb|CO514325.1|CO514325 s13dSG84B0600045_157312 Glandular tr... 30 3.9
gb|L40327.1|ALFASPSYN Medicago sativa asparagine synthetase... 30 3.9
emb|X98617.1|MSSHP17KD M.sativa mRNA for 17kD heat shock pr... 30 3.9
>emb|Z50800.1|MSASET2MR M.sativa mRNA for ASET2
Length = 1193
Score = 95.6 bits (48), Expect = 8e-020
Identities = 51/52 (98%)
Strand = Plus / Plus
Query: 13 ggcggccgctctagaactagtggatcccccgggctgcaggaattcggcacga 64
||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13 ggcggacgctctagaactagtggatcccccgggctgcaggaattcggcacga 64
>gb|AJ410110.1|AJ410110 AJ410110 Medicago sativa library (Kalo P) Medicago sativa cDNA
clone U281, mRNA sequence
Length = 754
Score = 81.8 bits (41), Expect = 1e-015
Identities = 55/57 (96%), Gaps = 2/57 (3%)
Strand = Plus / Plus
Query: 8 gcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcggcacga 64
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||
Sbjct: 1 gcggtggcggccgctctagaa-tagtggatcccc-gggctgcaggaattcggcacga 55
>gb|DQ222912.1| Medicago sativa ferulate 5-hydroxylase (F5H-K10) mRNA, complete cds
Length = 1885
Score = 52.0 bits (26), Expect = 1e-006
Identities = 62/74 (83%)
Strand = Plus / Plus
Query: 524 atcaaggctatcatcatggacgtgatgtttggcgggacggagacggtggcgtcggcgatc 583
||||| || ||||| ||||||||||||||||| || ||||| ||||| || || || |||
Sbjct: 995 atcaaagccatcataatggacgtgatgtttggaggaacggaaacggtagcatcagcaatc 1054
Query: 584 gagtgggcgatggc 597
|| ||||| |||||
Sbjct: 1055 gaatgggctatggc 1068
>gb|DQ222911.1| Medicago sativa ferulate 5-hydroxylase (F5H-K1) mRNA, complete cds
Length = 1904
Score = 46.1 bits (23), Expect = 7e-005
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 524 atcaaggctatcatcatggacgtgatgtttggcgggacggagacggt 570
||||| || ||||| ||||||||||||||||| || ||||| |||||
Sbjct: 1009 atcaaagccatcataatggacgtgatgtttggaggaacggaaacggt 1055
>gb|CO513719.1|CO513719 s13dSG15C1000070_140220 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 330
Score = 30.2 bits (15), Expect = 3.9
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1287 tggtcgatgttgtag 1301
|||||||||||||||
Sbjct: 226 tggtcgatgttgtag 212
>gb|CO514116.1|CO514116 s13dSG75E0100003_156894 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 508
Score = 30.2 bits (15), Expect = 3.9
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1324 tcaattttttttatt 1338
|||||||||||||||
Sbjct: 317 tcaattttttttatt 331
>gb|CO514325.1|CO514325 s13dSG84B0600045_157312 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 491
Score = 30.2 bits (15), Expect = 3.9
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 395 gacgccgacgccgac 409
|||||||||||||||
Sbjct: 143 gacgccgacgccgac 157
>gb|L40327.1|ALFASPSYN Medicago sativa asparagine synthetase gene, exons 1-13 and complete
cds
Length = 7969
Score = 30.2 bits (15), Expect = 3.9
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 45 gctgcaggaattcgg 59
|||||||||||||||
Sbjct: 7969 gctgcaggaattcgg 7955
>emb|X98617.1|MSSHP17KD M.sativa mRNA for 17kD heat shock protein
Length = 740
Score = 30.2 bits (15), Expect = 3.9
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 135 tcatcttcaacctga 149
|||||||||||||||
Sbjct: 257 tcatcttcaacctga 243
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: May 2, 2006 2:40 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1426
Number of Sequences: 7669
Number of extensions: 1426
Number of successful extensions: 361
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 344
Number of HSP's gapped (non-prelim): 15
length of query: 1360
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1344
effective length of database: 3,623,002
effective search space: 4869314688
effective search space used: 4869314688
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)