BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= C4H2
(1794 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|L11046.1|ALFEICA4HA Medicago sativa elicitor-inducible c... 72 1e-012
gb|CO515318.1|CO515318 s13dSG48E0800067_417695 Glandular tr... 64 4e-010
gb|CO513037.1|CO513037 s13dSG09H0900076_122000 Glandular tr... 38 0.021
gb|CO516664.1|CO516664 s13dSG66H0600058_446656 Glandular tr... 34 0.32
gb|CO515672.1|CO515672 s13dSG60D0900078_419493 Glandular tr... 32 1.3
gb|CO516233.1|CO516233 s13dSG69A0700051_445794 Glandular tr... 32 1.3
gb|CO516707.1|CO516707 s13dSG74D0500043_446742 Glandular tr... 32 1.3
gb|AF322116.2|AF322116 Medicago sativa sucrose-phosphate sy... 32 1.3
gb|AY468362.2| Medicago sativa sucrose-phosphate synthase g... 32 1.3
gb|AW698457.1|AW698457 g410 glandular-haired subtracted cDN... 30 5.0
gb|AW698718.1|AW698718 R98 non-glandular-haired subtracted ... 30 5.0
gb|CO512983.1|CO512983 s13dSG09B0800061_121892 Glandular tr... 30 5.0
gb|CO515179.1|CO515179 s13dSG62C1100086_399223 Glandular tr... 30 5.0
emb|AJ224336.1|MSAJ4336 Medicago sativa mRNA for MAP kinase... 30 5.0
>gb|L11046.1|ALFEICA4HA Medicago sativa elicitor-inducible cinnamic acid 4-hydroxylase
mRNA, complete cds
Length = 1744
Score = 71.9 bits (36), Expect = 1e-012
Identities = 69/80 (86%)
Strand = Plus / Plus
Query: 425 gacatggtgttcaccgtgtacggcgaccactggcgcaagatgcgccgcatcatgaccgtg 484
|||||||||||||| || |||||||| || ||||| || |||||| | |||||||||||
Sbjct: 375 gacatggtgttcactgtctacggcgaacattggcgtaaaatgcgcagaatcatgaccgtt 434
Query: 485 cccttcttcaccaacaaggt 504
|| |||||||| ||||||||
Sbjct: 435 cctttcttcacaaacaaggt 454
Score = 38.2 bits (19), Expect = 0.021
Identities = 67/83 (80%)
Strand = Plus / Plus
Query: 914 attgatcacatactggaggcacagcagaagggtgagatcaacgaggacaacgtgctcttc 973
||||||||||| |||| || || |||||||||| ||||| || |||||||| || | |
Sbjct: 867 attgatcacattttggatgctcaaaagaagggtgaaatcaatgatgacaacgttctttac 926
Query: 974 atcgtcgagaacattaacgttgc 996
|| || |||||||| || |||||
Sbjct: 927 attgttgagaacatcaatgttgc 949
Score = 36.2 bits (18), Expect = 0.081
Identities = 42/50 (84%)
Strand = Plus / Plus
Query: 204 tcttcgggaactggctgcaggtcggcgacgacctcaaccaccgcaacctc 253
||||||| ||||||| || ||||| || || ||||||||||| ||||||
Sbjct: 154 tcttcggatactggcttcaagtcggagatgatctcaaccaccgtaacctc 203
Score = 32.2 bits (16), Expect = 1.3
Identities = 19/20 (95%)
Strand = Plus / Plus
Query: 1247 atccccgccgagagcaagat 1266
||||| ||||||||||||||
Sbjct: 1200 atcccagccgagagcaagat 1219
>gb|CO515318.1|CO515318 s13dSG48E0800067_417695 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 557
Score = 64.0 bits (32), Expect = 4e-010
Identities = 95/116 (81%)
Strand = Plus / Plus
Query: 389 aacgtggtcttcgacatcttcacggacaaggggcaggacatggtgttcaccgtgtacggc 448
||||| || |||||||||||||| || || || |||||||||||||| || ||||||
Sbjct: 172 aacgtagttttcgacatcttcacaagtaaaggacaagacatggtgttcactgtctacggc 231
Query: 449 gaccactggcgcaagatgcgccgcatcatgaccgtgcccttcttcaccaacaaggt 504
|| || ||||| || ||||| | ||||||||||| || |||||||| ||||||||
Sbjct: 232 gaacattggcgtaaaatgcgtagaatcatgaccgttccgttcttcacaaacaaggt 287
>gb|CO513037.1|CO513037 s13dSG09H0900076_122000 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 526
Score = 38.2 bits (19), Expect = 0.021
Identities = 67/83 (80%)
Strand = Plus / Plus
Query: 914 attgatcacatactggaggcacagcagaagggtgagatcaacgaggacaacgtgctcttc 973
||||||||||| |||| || || |||||||||| ||||| || |||||||| || | |
Sbjct: 399 attgatcacattttggatgctcaaaagaagggtgaaatcaatgatgacaacgttctttac 458
Query: 974 atcgtcgagaacattaacgttgc 996
|| || |||||||| || |||||
Sbjct: 459 attgttgagaacatcaatgttgc 481
>gb|CO516664.1|CO516664 s13dSG66H0600058_446656 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 463
Score = 34.2 bits (17), Expect = 0.32
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 1727 tgttatttgcaacaaag 1743
|||||||||||||||||
Sbjct: 337 tgttatttgcaacaaag 353
>gb|CO515672.1|CO515672 s13dSG60D0900078_419493 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 572
Score = 32.2 bits (16), Expect = 1.3
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 833 ctcttcaaggatttct 848
||||||||||||||||
Sbjct: 375 ctcttcaaggatttct 360
>gb|CO516233.1|CO516233 s13dSG69A0700051_445794 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 560
Score = 32.2 bits (16), Expect = 1.3
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 396 tcttcgacatcttcac 411
||||||||||||||||
Sbjct: 469 tcttcgacatcttcac 484
>gb|CO516707.1|CO516707 s13dSG74D0500043_446742 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 527
Score = 32.2 bits (16), Expect = 1.3
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 1727 tgttatttgcaacaaa 1742
||||||||||||||||
Sbjct: 28 tgttatttgcaacaaa 13
>gb|AF322116.2|AF322116 Medicago sativa sucrose-phosphate synthase mRNA, complete cds
Length = 3579
Score = 32.2 bits (16), Expect = 1.3
Identities = 19/20 (95%)
Strand = Plus / Plus
Query: 939 agaagggtgagatcaacgag 958
|||||||||||| |||||||
Sbjct: 2820 agaagggtgagagcaacgag 2839
>gb|AY468362.2| Medicago sativa sucrose-phosphate synthase gene, promoter region and
complete cds
Length = 8933
Score = 32.2 bits (16), Expect = 1.3
Identities = 19/20 (95%)
Strand = Plus / Plus
Query: 939 agaagggtgagatcaacgag 958
|||||||||||| |||||||
Sbjct: 7783 agaagggtgagagcaacgag 7802
>gb|AW698457.1|AW698457 g410 glandular-haired subtracted cDNA library Medicago sativa cDNA,
mRNA sequence
Length = 240
Score = 30.2 bits (15), Expect = 5.0
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1382 ttcaggtacctgccc 1396
|||||||||||||||
Sbjct: 226 ttcaggtacctgccc 240
>gb|AW698718.1|AW698718 R98 non-glandular-haired subtracted cDNA library Medicago sativa
cDNA, mRNA sequence
Length = 330
Score = 30.2 bits (15), Expect = 5.0
Identities = 18/19 (94%)
Strand = Plus / Minus
Query: 1495 gccgcccgggcaggacaag 1513
|||||||||||||| ||||
Sbjct: 323 gccgcccgggcaggtcaag 305
>gb|CO512983.1|CO512983 s13dSG09B0800061_121892 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 504
Score = 30.2 bits (15), Expect = 5.0
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 910 cgccattgatcacat 924
|||||||||||||||
Sbjct: 42 cgccattgatcacat 56
>gb|CO515179.1|CO515179 s13dSG62C1100086_399223 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 503
Score = 30.2 bits (15), Expect = 5.0
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1353 agaagcacgtcgagg 1367
|||||||||||||||
Sbjct: 259 agaagcacgtcgagg 273
>emb|AJ224336.1|MSAJ4336 Medicago sativa mRNA for MAP kinase, complete CDS
Length = 1442
Score = 30.2 bits (15), Expect = 5.0
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 946 tgagatcaacgagga 960
|||||||||||||||
Sbjct: 1023 tgagatcaacgagga 1037
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: May 2, 2006 2:40 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.38 0.711 1.31
Gapped
Lambda K H
1.38 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2941
Number of Sequences: 7669
Number of extensions: 2941
Number of successful extensions: 687
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 667
Number of HSP's gapped (non-prelim): 20
length of query: 1794
length of database: 3,745,706
effective HSP length: 17
effective length of query: 1777
effective length of database: 3,615,333
effective search space: 6424446741
effective search space used: 6424446741
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.8 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)