BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 4CL
(1986 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO513458.1|CO513458 s13dSG10D1100090_130080 Glandular tr... 36 0.092
gb|CO513938.1|CO513938 s13dSG71D0800062_156538 Glandular tr... 36 0.092
gb|CO516292.1|CO516292 s13dSG69F0800073_445912 Glandular tr... 36 0.092
gb|AJ410165.1|AJ410165 AJ410165 Medicago sativa library (Ka... 34 0.36
gb|CO512582.1|CO512582 s13dSG08H0300028_121090 Glandular tr... 34 0.36
gb|CO513420.1|CO513420 s13dSG38H0600048_130004 Glandular tr... 34 0.36
gb|CO513214.1|CO513214 s13dSG24C0700050_129592 Glandular tr... 32 1.4
emb|Y11607.1|MSMP2C M.sativa mRNA for protein phosphatase 2C 32 1.4
gb|AJ410156.1|AJ410156 AJ410156 Medicago sativa library (Ka... 30 5.7
gb|CO511750.1|CO511750 s13dSG01F0600059_103400 Glandular tr... 30 5.7
gb|CO511761.1|CO511761 s13dSG01G0600052_103422 Glandular tr... 30 5.7
gb|CO511763.1|CO511763 s13dSG01G0800068_103426 Glandular tr... 30 5.7
gb|CO511767.1|CO511767 s13dSG01H0100016_103434 Glandular tr... 30 5.7
gb|CO511774.1|CO511774 s13dSG01H0800076_103448 Glandular tr... 30 5.7
gb|CO511783.1|CO511783 s13dSG02A0500037_103466 Glandular tr... 30 5.7
gb|CO511816.1|CO511816 s13dSG02D0200026_103532 Glandular tr... 30 5.7
gb|CO511843.1|CO511843 s13dSG02F0500047_103586 Glandular tr... 30 5.7
gb|CO511874.1|CO511874 s13dSG05A0400033_103648 Glandular tr... 30 5.7
gb|CO511877.1|CO511877 s13dSG05A0700053_103654 Glandular tr... 30 5.7
gb|CO511881.1|CO511881 s13dSG05A1200097_103662 Glandular tr... 30 5.7
gb|CO511883.1|CO511883 s13dSG05B0300029_103666 Glandular tr... 30 5.7
gb|CO511910.1|CO511910 s13dSG05D1000090_103720 Glandular tr... 30 5.7
gb|CO511926.1|CO511926 s13dSG05F0800075_103752 Glandular tr... 30 5.7
gb|CO511948.1|CO511948 s13dSG05H0800076_103796 Glandular tr... 30 5.7
gb|CO511965.1|CO511965 s13dSG07B1100093_103830 Glandular tr... 30 5.7
gb|CO511968.1|CO511968 s13dSG07C0200018_103836 Glandular tr... 30 5.7
gb|CO511974.1|CO511974 s13dSG07C0900070_103848 Glandular tr... 30 5.7
gb|CO511980.1|CO511980 s13dSG07D0400042_103860 Glandular tr... 30 5.7
gb|CO511993.1|CO511993 s13dSG07E0500039_103886 Glandular tr... 30 5.7
gb|CO512007.1|CO512007 s13dSG07F1000091_103914 Glandular tr... 30 5.7
gb|CO512011.1|CO512011 s13dSG07G0500040_103922 Glandular tr... 30 5.7
gb|CO512058.1|CO512058 s13dSG18D0300026_108436 Glandular tr... 30 5.7
gb|CO512125.1|CO512125 s13dSG34B0900073_108570 Glandular tr... 30 5.7
gb|CO512156.1|CO512156 s13dSG34E1200087_108632 Glandular tr... 30 5.7
gb|CO512164.1|CO512164 s13dSG34F1000079_108648 Glandular tr... 30 5.7
gb|CO512203.1|CO512203 s13dSG03C0300018_113920 Glandular tr... 30 5.7
gb|CO512210.1|CO512210 s13dSG03C1000070_113934 Glandular tr... 30 5.7
gb|CO512216.1|CO512216 s13dSG03D0400030_113946 Glandular tr... 30 5.7
gb|CO512230.1|CO512230 s13dSG03E0700051_113974 Glandular tr... 30 5.7
gb|CO512264.1|CO512264 s13dSG03H0800064_114042 Glandular tr... 30 5.7
gb|CO512312.1|CO512312 s13dSG68E0400023_114138 Glandular tr... 30 5.7
gb|CO512320.1|CO512320 s13dSG68F0100011_114154 Glandular tr... 30 5.7
gb|CO512324.1|CO512324 s13dSG68F0500043_114162 Glandular tr... 30 5.7
gb|CO512368.1|CO512368 s13dSG80B0300025_114250 Glandular tr... 30 5.7
gb|CO512376.1|CO512376 s13dSG80B1200093_114266 Glandular tr... 30 5.7
gb|CO512381.1|CO512381 s13dSG80C0500034_114276 Glandular tr... 30 5.7
gb|CO512425.1|CO512425 s13dSG80G0400024_114364 Glandular tr... 30 5.7
gb|CO512434.1|CO512434 s13dSG80H0300028_114382 Glandular tr... 30 5.7
gb|CO512443.1|CO512443 s13dSG100A010000_114400 Glandular tr... 30 5.7
gb|CO512473.1|CO512473 s13dSG100D090007_114460 Glandular tr... 30 5.7
gb|CO512481.1|CO512481 s13dSG100E060003_114476 Glandular tr... 30 5.7
gb|CO512506.1|CO512506 s13dSG100H030002_114526 Glandular tr... 30 5.7
gb|CO512520.1|CO512520 s13dSG08A1000069_120966 Glandular tr... 30 5.7
gb|CO512522.1|CO512522 s13dSG08A1200085_120970 Glandular tr... 30 5.7
gb|CO512549.1|CO512549 s13dSG08D1000078_121024 Glandular tr... 30 5.7
gb|CO512571.1|CO512571 s13dSG08F1000079_121068 Glandular tr... 30 5.7
gb|CO512586.1|CO512586 s13dSG08H0800064_121098 Glandular tr... 30 5.7
gb|CO512619.1|CO512619 s13dSG13D0700058_121164 Glandular tr... 30 5.7
gb|CO512636.1|CO512636 s13dSG13F0700059_121198 Glandular tr... 30 5.7
gb|CO512648.1|CO512648 s13dSG13H0300028_121222 Glandular tr... 30 5.7
gb|CO512670.1|CO512670 s13dSG19B1200093_121266 Glandular tr... 30 5.7
gb|CO512701.1|CO512701 s13dSG19F0200015_121328 Glandular tr... 30 5.7
gb|CO512707.1|CO512707 s13dSG19F0900075_121340 Glandular tr... 30 5.7
gb|CO512710.1|CO512710 s13dSG19G0100004_121346 Glandular tr... 30 5.7
gb|CO512715.1|CO512715 s13dSG19G0600040_121356 Glandular tr... 30 5.7
gb|CO512772.1|CO512772 s13dSG88E0200007_121470 Glandular tr... 30 5.7
gb|CO512844.1|CO512844 s13dSG20D0700058_121614 Glandular tr... 30 5.7
gb|CO512853.1|CO512853 s13dSG20E0400023_121632 Glandular tr... 30 5.7
gb|CO512861.1|CO512861 s13dSG20E1200087_121648 Glandular tr... 30 5.7
gb|CO512875.1|CO512875 s13dSG20G0500036_121676 Glandular tr... 30 5.7
gb|CO512886.1|CO512886 s13dSG20H0600048_121698 Glandular tr... 30 5.7
gb|CO512895.1|CO512895 s13dSG86A0500033_121716 Glandular tr... 30 5.7
gb|CO512898.1|CO512898 s13dSG86A1100081_121722 Glandular tr... 30 5.7
gb|CO512902.1|CO512902 s13dSG86B0400029_121730 Glandular tr... 30 5.7
gb|CO512919.1|CO512919 s13dSG86D0200014_121764 Glandular tr... 30 5.7
gb|CO512920.1|CO512920 s13dSG86D0300026_121766 Glandular tr... 30 5.7
gb|CO512930.1|CO512930 s13dSG86E0400023_121786 Glandular tr... 30 5.7
gb|CO513008.1|CO513008 s13dSG09E0500035_121942 Glandular tr... 30 5.7
gb|CO513020.1|CO513020 s13dSG09F0900075_121966 Glandular tr... 30 5.7
gb|CO513034.1|CO513034 s13dSG09H0300028_121994 Glandular tr... 30 5.7
gb|CO513042.1|CO513042 s13dSG89A0200005_122010 Glandular tr... 30 5.7
gb|CO513048.1|CO513048 s13dSG89B0200013_122022 Glandular tr... 30 5.7
gb|CO513064.1|CO513064 s13dSG89D0100010_122054 Glandular tr... 30 5.7
gb|CO513080.1|CO513080 s13dSG89E0600039_122086 Glandular tr... 30 5.7
gb|CO513098.1|CO513098 s13dSG89G1000072_122122 Glandular tr... 30 5.7
gb|CO513100.1|CO513100 s13dSG89G1200088_122126 Glandular tr... 30 5.7
gb|CO513111.1|CO513111 s13dSG23A0200005_129386 Glandular tr... 30 5.7
gb|CO513123.1|CO513123 s13dSG23B0600045_129410 Glandular tr... 30 5.7
gb|CO513151.1|CO513151 s13dSG23D1200094_129466 Glandular tr... 30 5.7
gb|CO513233.1|CO513233 s13dSG24E0700051_129630 Glandular tr... 30 5.7
gb|CO513237.1|CO513237 s13dSG24E1100083_129638 Glandular tr... 30 5.7
gb|CO513239.1|CO513239 s13dSG24F0200015_129642 Glandular tr... 30 5.7
gb|CO513258.1|CO513258 s13dSG24H0100012_129680 Glandular tr... 30 5.7
gb|CO513289.1|CO513289 s13dSG37C0600038_129742 Glandular tr... 30 5.7
gb|CO513292.1|CO513292 s13dSG37C0900066_129748 Glandular tr... 30 5.7
gb|CO513293.1|CO513293 s13dSG37C1100082_129750 Glandular tr... 30 5.7
gb|CO513311.1|CO513311 s13dSG37E0900067_129786 Glandular tr... 30 5.7
gb|CO513317.1|CO513317 s13dSG37F0300027_129798 Glandular tr... 30 5.7
gb|CO513326.1|CO513326 s13dSG37F1200095_129816 Glandular tr... 30 5.7
gb|CO513335.1|CO513335 s13dSG37G0900068_129834 Glandular tr... 30 5.7
gb|CO513345.1|CO513345 s13dSG37H0800064_129854 Glandular tr... 30 5.7
gb|CO513368.1|CO513368 s13dSG38B1100089_129900 Glandular tr... 30 5.7
gb|CO513377.1|CO513377 s13dSG38C1200086_129918 Glandular tr... 30 5.7
gb|CO513388.1|CO513388 s13dSG38E0200007_129940 Glandular tr... 30 5.7
gb|CO513426.1|CO513426 s13dSG10A0100001_130016 Glandular tr... 30 5.7
gb|CO513427.1|CO513427 s13dSG10A0300017_130018 Glandular tr... 30 5.7
gb|CO513457.1|CO513457 s13dSG10D1000078_130078 Glandular tr... 30 5.7
gb|CO513511.1|CO513511 s13dSG12C0400022_139804 Glandular tr... 30 5.7
gb|CO513515.1|CO513515 s13dSG12C0900066_139812 Glandular tr... 30 5.7
gb|CO513518.1|CO513518 s13dSG12C1200086_139818 Glandular tr... 30 5.7
gb|CO513524.1|CO513524 s13dSG12D1200094_139830 Glandular tr... 30 5.7
gb|CO513572.1|CO513572 s13dSG16A1000069_139926 Glandular tr... 30 5.7
gb|CO513597.1|CO513597 s13dSG16D0500042_139976 Glandular tr... 30 5.7
gb|CO513653.1|CO513653 s13dSG17C1000070_140088 Glandular tr... 30 5.7
gb|CO513670.1|CO513670 s13dSG17E1200087_140122 Glandular tr... 30 5.7
gb|CO513681.1|CO513681 s13dSG17G0200008_140144 Glandular tr... 30 5.7
gb|CO513693.1|CO513693 s13dSG15A0500033_140168 Glandular tr... 30 5.7
gb|CO513698.1|CO513698 s13dSG15A1100081_140178 Glandular tr... 30 5.7
gb|CO513711.1|CO513711 s13dSG15C0200006_140204 Glandular tr... 30 5.7
gb|CO513748.1|CO513748 s13dSG15F1200095_140278 Glandular tr... 30 5.7
gb|CO513752.1|CO513752 s13dSG15G0500036_140286 Glandular tr... 30 5.7
gb|CO513753.1|CO513753 s13dSG15G0600040_140288 Glandular tr... 30 5.7
gb|CO513761.1|CO513761 s13dSG15H0600048_140304 Glandular tr... 30 5.7
gb|CO513786.1|CO513786 s13dSG82E0100003_156234 Glandular tr... 30 5.7
gb|CO513817.1|CO513817 s13dSG73A0300017_156296 Glandular tr... 30 5.7
gb|CO513862.1|CO513862 s13dSG73E0200007_156386 Glandular tr... 30 5.7
gb|CO513878.1|CO513878 s13dSG73F0600047_156418 Glandular tr... 30 5.7
gb|CO513881.1|CO513881 s13dSG73F0900075_156424 Glandular tr... 30 5.7
gb|CO513902.1|CO513902 s13dSG73H0800064_156466 Glandular tr... 30 5.7
gb|CO513988.1|CO513988 s13dSG72A0500033_156638 Glandular tr... 30 5.7
gb|CO514009.1|CO514009 s13dSG72C0400022_156680 Glandular tr... 30 5.7
gb|CO514041.1|CO514041 s13dSG72F0300027_156744 Glandular tr... 30 5.7
gb|CO514052.1|CO514052 s13dSG72G0500036_156766 Glandular tr... 30 5.7
gb|CO514057.1|CO514057 s13dSG72G1000072_156776 Glandular tr... 30 5.7
gb|CO514064.1|CO514064 s13dSG72H0700060_156790 Glandular tr... 30 5.7
gb|CO514069.1|CO514069 s13dSG72H1200096_156800 Glandular tr... 30 5.7
gb|CO514071.1|CO514071 s13dSG75A0200005_156804 Glandular tr... 30 5.7
gb|CO514080.1|CO514080 s13dSG75A1200085_156822 Glandular tr... 30 5.7
gb|CO514081.1|CO514081 s13dSG75B0100009_156824 Glandular tr... 30 5.7
gb|CO514119.1|CO514119 s13dSG75E0400023_156900 Glandular tr... 30 5.7
gb|CO514138.1|CO514138 s13dSG75F1200095_156938 Glandular tr... 30 5.7
gb|CO514235.1|CO514235 s13dSG76B0300025_157132 Glandular tr... 30 5.7
gb|CO514242.1|CO514242 s13dSG76B1000077_157146 Glandular tr... 30 5.7
gb|CO514258.1|CO514258 s13dSG76D0400030_157178 Glandular tr... 30 5.7
gb|CO514283.1|CO514283 s13dSG76F0600047_157228 Glandular tr... 30 5.7
gb|CO514293.1|CO514293 s13dSG76G0400024_157248 Glandular tr... 30 5.7
gb|CO514304.1|CO514304 s13dSG76H0500044_157270 Glandular tr... 30 5.7
gb|CO514434.1|CO514434 s13dSG36F0400041_327528 Glandular tr... 30 5.7
gb|CO514435.1|CO514435 s13dSG36F0500045_327530 Glandular tr... 30 5.7
gb|CO514436.1|CO514436 s13dSG36F0700061_327532 Glandular tr... 30 5.7
gb|CO514445.1|CO514445 s13dSG36G0900070_327550 Glandular tr... 30 5.7
gb|CO514477.1|CO514477 s13dSG43B0800063_327614 Glandular tr... 30 5.7
gb|CO514494.1|CO514494 s13dSG43D0600048_327648 Glandular tr... 30 5.7
gb|CO514496.1|CO514496 s13dSG43D0900076_327652 Glandular tr... 30 5.7
gb|CO514503.1|CO514503 s13dSG43E0400033_327666 Glandular tr... 30 5.7
gb|CO514521.1|CO514521 s13dSG43G0100006_327702 Glandular tr... 30 5.7
gb|CO514540.1|CO514540 s13dSG43H1100094_327740 Glandular tr... 30 5.7
gb|CO514547.1|CO514547 s13dSG42A0800065_327754 Glandular tr... 30 5.7
gb|CO514568.1|CO514568 s13dSG42C0800066_327796 Glandular tr... 30 5.7
gb|CO514571.1|CO514571 s13dSG42C1100086_327802 Glandular tr... 30 5.7
gb|CO514584.1|CO514584 s13dSG42E0400035_327828 Glandular tr... 30 5.7
gb|CO514614.1|CO514614 s13dSG42H0500048_327888 Glandular tr... 30 5.7
gb|CO514686.1|CO514686 s13dSG46H0300032_328032 Glandular tr... 30 5.7
gb|CO514692.1|CO514692 s13dSG46H1000092_328044 Glandular tr... 30 5.7
gb|CO514694.1|CO514694 s13dSG46H1200104_328048 Glandular tr... 30 5.7
gb|CO514697.1|CO514697 s13dSG55A0400033_328054 Glandular tr... 30 5.7
gb|CO514797.1|CO514797 s13dSG59C1100086_328254 Glandular tr... 30 5.7
gb|CO514865.1|CO514865 s13dSG56C0700054_328390 Glandular tr... 30 5.7
gb|CO514875.1|CO514875 s13dSG56D0600058_328410 Glandular tr... 30 5.7
gb|CO514895.1|CO514895 s13dSG56F0700063_328450 Glandular tr... 30 5.7
gb|CO514916.1|CO514916 s13dSG63A0200017_397337 Glandular tr... 30 5.7
gb|CO514941.1|CO514941 s13dSG63C0800066_397387 Glandular tr... 30 5.7
gb|CO514956.1|CO514956 s13dSG63E0400035_397417 Glandular tr... 30 5.7
gb|CO514979.1|CO514979 s13dSG63G1200100_397463 Glandular tr... 30 5.7
gb|CO514984.1|CO514984 s13dSG63H0600060_397473 Glandular tr... 30 5.7
gb|CO514987.1|CO514987 s13dSG63H1000092_397479 Glandular tr... 30 5.7
gb|CO515031.1|CO515031 s13dSG26F0500047_397567 Glandular tr... 30 5.7
gb|CO515033.1|CO515033 s13dSG26F0700063_397571 Glandular tr... 30 5.7
gb|CO515041.1|CO515041 s13dSG26G0900072_397587 Glandular tr... 30 5.7
gb|CO515067.1|CO515067 s13dSG97D0500046_397639 Glandular tr... 30 5.7
gb|CO515085.1|CO515085 s13dSG97H0800076_397675 Glandular tr... 30 5.7
gb|CO515093.1|CO515093 s13dSG40A1100085_399051 Glandular tr... 30 5.7
gb|CO515113.1|CO515113 s13dSG40D0300030_399091 Glandular tr... 30 5.7
gb|CO515146.1|CO515146 s13dSG40H0500048_399157 Glandular tr... 30 5.7
gb|CO515166.1|CO515166 s13dSG62B0800073_399197 Glandular tr... 30 5.7
gb|CO515184.1|CO515184 s13dSG62D0400042_399233 Glandular tr... 30 5.7
gb|CO515190.1|CO515190 s13dSG62D1100094_399245 Glandular tr... 30 5.7
gb|CO515207.1|CO515207 s13dSG62G0800068_399279 Glandular tr... 30 5.7
gb|CO515213.1|CO515213 s13dSG62H0900080_399291 Glandular tr... 30 5.7
gb|CO515231.1|CO515231 s13dSG96C0100006_399327 Glandular tr... 30 5.7
gb|CO515239.1|CO515239 s13dSG96D0600058_399343 Glandular tr... 30 5.7
gb|CO515243.1|CO515243 s13dSG96D1000090_399351 Glandular tr... 30 5.7
gb|CO515261.1|CO515261 s13dSG96G0700056_399387 Glandular tr... 30 5.7
gb|CO515317.1|CO515317 s13dSG48E0700055_417693 Glandular tr... 30 5.7
gb|CO515328.1|CO515328 s13dSG48F1000091_417715 Glandular tr... 30 5.7
gb|CO515364.1|CO515364 s13dSG49C0700054_417787 Glandular tr... 30 5.7
gb|CO515371.1|CO515371 s13dSG49D0200026_417801 Glandular tr... 30 5.7
gb|CO515388.1|CO515388 s13dSG49E1200099_417835 Glandular tr... 30 5.7
gb|CO515505.1|CO515505 s13dSG52D1000090_418069 Glandular tr... 30 5.7
gb|CO515566.1|CO515566 s13dSG53G0900072_418191 Glandular tr... 30 5.7
gb|CO515603.1|CO515603 s13dSG47D0900078_418265 Glandular tr... 30 5.7
gb|CO515604.1|CO515604 s13dSG47D1000090_418267 Glandular tr... 30 5.7
gb|CO515616.1|CO515616 s13dSG47E1200099_418291 Glandular tr... 30 5.7
gb|CO515619.1|CO515619 s13dSG47F1200103_418297 Glandular tr... 30 5.7
gb|CO515681.1|CO515681 s13dSG60E0900071_419511 Glandular tr... 30 5.7
gb|CO515717.1|CO515717 s13dSG77A0700053_419583 Glandular tr... 30 5.7
gb|CO515742.1|CO515742 s13dSG77C0900070_419633 Glandular tr... 30 5.7
gb|CO515746.1|CO515746 s13dSG77D0200026_419641 Glandular tr... 30 5.7
gb|CO515752.1|CO515752 s13dSG77D0800074_419653 Glandular tr... 30 5.7
gb|CO515797.1|CO515797 s13dSG54B0500042_421133 Glandular tr... 30 5.7
gb|CO515807.1|CO515807 s13dSG54C0700052_421153 Glandular tr... 30 5.7
gb|CO515844.1|CO515844 s13dSG54G0200008_421227 Glandular tr... 30 5.7
gb|CO515867.1|CO515867 s13dSG91A0700051_421273 Glandular tr... 30 5.7
gb|CO515963.1|CO515963 s13dSG61D0100010_445254 Glandular tr... 30 5.7
gb|CO515968.1|CO515968 s13dSG61D0700062_445264 Glandular tr... 30 5.7
gb|CO515977.1|CO515977 s13dSG61E0400033_445282 Glandular tr... 30 5.7
gb|CO515979.1|CO515979 s13dSG61E0600051_445286 Glandular tr... 30 5.7
gb|CO515985.1|CO515985 s13dSG61E1200099_445298 Glandular tr... 30 5.7
gb|CO515994.1|CO515994 s13dSG61F1000091_445316 Glandular tr... 30 5.7
gb|CO516089.1|CO516089 s13dSG65B0200013_445506 Glandular tr... 30 5.7
gb|CO516095.1|CO516095 s13dSG65B1100093_445518 Glandular tr... 30 5.7
gb|CO516097.1|CO516097 s13dSG65C0100002_445522 Glandular tr... 30 5.7
gb|CO516099.1|CO516099 s13dSG65C0400024_445526 Glandular tr... 30 5.7
gb|CO516102.1|CO516102 s13dSG65C0900070_445532 Glandular tr... 30 5.7
gb|CO516118.1|CO516118 s13dSG65E1000083_445564 Glandular tr... 30 5.7
gb|CO516126.1|CO516126 s13dSG65F1000091_445580 Glandular tr... 30 5.7
gb|CO516138.1|CO516138 s13dSG65G1200100_445604 Glandular tr... 30 5.7
gb|CO516242.1|CO516242 s13dSG69B0500042_445812 Glandular tr... 30 5.7
gb|CO516243.1|CO516243 s13dSG69B0600046_445814 Glandular tr... 30 5.7
gb|CO516244.1|CO516244 s13dSG69B0700059_445816 Glandular tr... 30 5.7
gb|CO516300.1|CO516300 s13dSG69G0500037_445928 Glandular tr... 30 5.7
gb|CO516435.1|CO516435 s13dSG27G0900070_446198 Glandular tr... 30 5.7
gb|CO516467.1|CO516467 s13dSG28C0600040_446262 Glandular tr... 30 5.7
gb|CO516482.1|CO516482 s13dSG28D1100092_446292 Glandular tr... 30 5.7
gb|CO516578.1|CO516578 s13dSG57G1100086_446484 Glandular tr... 30 5.7
gb|CO516594.1|CO516594 s13dSG66A0700051_446516 Glandular tr... 30 5.7
gb|CO516600.1|CO516600 s13dSG66B0200013_446528 Glandular tr... 30 5.7
gb|CO516626.1|CO516626 s13dSG66D0800064_446580 Glandular tr... 30 5.7
gb|CO516631.1|CO516631 s13dSG66E0100003_446590 Glandular tr... 30 5.7
gb|CO516673.1|CO516673 s13dSG74A0500034_446674 Glandular tr... 30 5.7
gb|CO516684.1|CO516684 s13dSG74B0500042_446696 Glandular tr... 30 5.7
gb|CO516728.1|CO516728 s13dSG74F0600057_446784 Glandular tr... 30 5.7
gb|CO516747.1|CO516747 s13dSG74H0500045_446822 Glandular tr... 30 5.7
gb|CO516759.1|CO516759 s13dSG94A0900067_446846 Glandular tr... 30 5.7
gb|CO516766.1|CO516766 s13dSG94B0600046_446860 Glandular tr... 30 5.7
gb|CO516797.1|CO516797 s13dSG94F0700061_446922 Glandular tr... 30 5.7
gb|CO516819.1|CO516819 s13dSG98B0400029_446966 Glandular tr... 30 5.7
gb|CO516845.1|CO516845 s13dSG98D1200102_447018 Glandular tr... 30 5.7
gb|CO516892.1|CO516892 s13dSG58B0600046_468330 Glandular tr... 30 5.7
gb|CO516923.1|CO516923 s13dSG58E0600049_468392 Glandular tr... 30 5.7
gb|CO517034.1|CO517034 s13dSG31D0600048_468614 Glandular tr... 30 5.7
gb|CO517071.1|CO517071 s13dSG29A0900069_468688 Glandular tr... 30 5.7
gb|CO517092.1|CO517092 s13dSG29C0900070_468730 Glandular tr... 30 5.7
gb|CO517113.1|CO517113 s13dSG29F0100015_468772 Glandular tr... 30 5.7
gb|CO517169.1|CO517169 s13dSG33D1000090_474422 Glandular tr... 30 5.7
gb|CO517172.1|CO517172 s13dSG33E0400035_474428 Glandular tr... 30 5.7
gb|CO517203.1|CO517203 s13dSG33H1200104_474490 Glandular tr... 30 5.7
gb|CO517216.1|CO517216 s13dSG32B0500045_486028 Glandular tr... 30 5.7
gb|CO517245.1|CO517245 s13dSG32E0600051_486086 Glandular tr... 30 5.7
gb|CO517270.1|CO517270 s13dSG32H0200028_486136 Glandular tr... 30 5.7
gb|U13709.1|MSU13709 Medicago sativa Nagyszenasi pathogenes... 30 5.7
gb|AF042068.1|AF042068 Medicago sativa MADS-box protein NMH... 30 5.7
gb|DQ122797.1| Medicago sativa clone QB12 lipid transfer pr... 30 5.7
>gb|CO513458.1|CO513458 s13dSG10D1100090_130080 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 578
Score = 36.2 bits (18), Expect = 0.092
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1459 gagatcttcatcgtcgac 1476
||||||||||||||||||
Sbjct: 265 gagatcttcatcgtcgac 282
>gb|CO513938.1|CO513938 s13dSG71D0800062_156538 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 552
Score = 36.2 bits (18), Expect = 0.092
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1459 gagatcttcatcgtcgac 1476
||||||||||||||||||
Sbjct: 262 gagatcttcatcgtcgac 279
>gb|CO516292.1|CO516292 s13dSG69F0800073_445912 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 509
Score = 36.2 bits (18), Expect = 0.092
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1459 gagatcttcatcgtcgac 1476
||||||||||||||||||
Sbjct: 363 gagatcttcatcgtcgac 380
>gb|AJ410165.1|AJ410165 AJ410165 Medicago sativa library (Kalo P) Medicago sativa cDNA
clone U833, mRNA sequence
Length = 707
Score = 34.2 bits (17), Expect = 0.36
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 734 cgtactcgtccggcacgacgg 754
||||||| |||||||||||||
Sbjct: 200 cgtactcctccggcacgacgg 180
>gb|CO512582.1|CO512582 s13dSG08H0300028_121090 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 593
Score = 34.2 bits (17), Expect = 0.36
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 1559 tcgtcgacgccgccgtc 1575
|||||||||||||||||
Sbjct: 95 tcgtcgacgccgccgtc 111
>gb|CO513420.1|CO513420 s13dSG38H0600048_130004 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 454
Score = 34.2 bits (17), Expect = 0.36
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 1559 tcgtcgacgccgccgtc 1575
|||||||||||||||||
Sbjct: 16 tcgtcgacgccgccgtc 32
>gb|CO513214.1|CO513214 s13dSG24C0700050_129592 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 578
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccacg 483
||||||||||||||||
Sbjct: 244 cgccgccgccaccacg 259
>emb|Y11607.1|MSMP2C M.sativa mRNA for protein phosphatase 2C
Length = 1499
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 1890 atatatatacagaaaa 1905
||||||||||||||||
Sbjct: 1308 atatatatacagaaaa 1293
>gb|AJ410156.1|AJ410156 AJ410156 Medicago sativa library (Kalo P) Medicago sativa cDNA
clone U782, mRNA sequence
Length = 572
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 186 cgccgccgccaccac 200
>gb|CO511750.1|CO511750 s13dSG01F0600059_103400 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 507
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO511761.1|CO511761 s13dSG01G0600052_103422 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 535
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO511763.1|CO511763 s13dSG01G0800068_103426 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 521
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO511767.1|CO511767 s13dSG01H0100016_103434 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 522
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO511774.1|CO511774 s13dSG01H0800076_103448 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 569
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO511783.1|CO511783 s13dSG02A0500037_103466 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 503
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO511816.1|CO511816 s13dSG02D0200026_103532 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 603
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO511843.1|CO511843 s13dSG02F0500047_103586 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 239 cgccgccgccaccac 253
>gb|CO511874.1|CO511874 s13dSG05A0400033_103648 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 526
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO511877.1|CO511877 s13dSG05A0700053_103654 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 470
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO511881.1|CO511881 s13dSG05A1200097_103662 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 593
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO511883.1|CO511883 s13dSG05B0300029_103666 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO511910.1|CO511910 s13dSG05D1000090_103720 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 606
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO511926.1|CO511926 s13dSG05F0800075_103752 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 525
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO511948.1|CO511948 s13dSG05H0800076_103796 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 546
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO511965.1|CO511965 s13dSG07B1100093_103830 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 606
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO511968.1|CO511968 s13dSG07C0200018_103836 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 504
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO511974.1|CO511974 s13dSG07C0900070_103848 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 521
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO511980.1|CO511980 s13dSG07D0400042_103860 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 629
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1230 gttaccggtgaagtc 1244
|||||||||||||||
Sbjct: 101 gttaccggtgaagtc 115
>gb|CO511993.1|CO511993 s13dSG07E0500039_103886 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 551
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512007.1|CO512007 s13dSG07F1000091_103914 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 605
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO512011.1|CO512011 s13dSG07G0500040_103922 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 577
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 240 cgccgccgccaccac 254
>gb|CO512058.1|CO512058 s13dSG18D0300026_108436 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 559
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO512125.1|CO512125 s13dSG34B0900073_108570 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 574
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512156.1|CO512156 s13dSG34E1200087_108632 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 605
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO512164.1|CO512164 s13dSG34F1000079_108648 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 607
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO512203.1|CO512203 s13dSG03C0300018_113920 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 560
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512210.1|CO512210 s13dSG03C1000070_113934 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 574
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512216.1|CO512216 s13dSG03D0400030_113946 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 576
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512230.1|CO512230 s13dSG03E0700051_113974 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 599
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 462 cctcggcgccgccgc 476
|||||||||||||||
Sbjct: 70 cctcggcgccgccgc 84
>gb|CO512264.1|CO512264 s13dSG03H0800064_114042 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 576
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512312.1|CO512312 s13dSG68E0400023_114138 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 521
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO512320.1|CO512320 s13dSG68F0100011_114154 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 560
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO512324.1|CO512324 s13dSG68F0500043_114162 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 522
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512368.1|CO512368 s13dSG80B0300025_114250 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 522
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512376.1|CO512376 s13dSG80B1200093_114266 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 544
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO512381.1|CO512381 s13dSG80C0500034_114276 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 527
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO512425.1|CO512425 s13dSG80G0400024_114364 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 524
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512434.1|CO512434 s13dSG80H0300028_114382 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 495
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 114 cgccgccgccaccac 128
>gb|CO512443.1|CO512443 s13dSG100A010000_114400 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 555
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512473.1|CO512473 s13dSG100D090007_114460 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512481.1|CO512481 s13dSG100E060003_114476 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 521
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512506.1|CO512506 s13dSG100H030002_114526 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 541
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO512520.1|CO512520 s13dSG08A1000069_120966 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 572
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512522.1|CO512522 s13dSG08A1200085_120970 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 603
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512549.1|CO512549 s13dSG08D1000078_121024 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 556
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO512571.1|CO512571 s13dSG08F1000079_121068 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 574
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512586.1|CO512586 s13dSG08H0800064_121098 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 571
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512619.1|CO512619 s13dSG13D0700058_121164 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 559
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO512636.1|CO512636 s13dSG13F0700059_121198 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 544
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512648.1|CO512648 s13dSG13H0300028_121222 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 522
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512670.1|CO512670 s13dSG19B1200093_121266 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 580
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 462 cctcggcgccgccgc 476
|||||||||||||||
Sbjct: 78 cctcggcgccgccgc 92
>gb|CO512701.1|CO512701 s13dSG19F0200015_121328 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 522
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512707.1|CO512707 s13dSG19F0900075_121340 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 555
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512710.1|CO512710 s13dSG19G0100004_121346 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 239 cgccgccgccaccac 253
>gb|CO512715.1|CO512715 s13dSG19G0600040_121356 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512772.1|CO512772 s13dSG88E0200007_121470 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 557
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 239 cgccgccgccaccac 253
>gb|CO512844.1|CO512844 s13dSG20D0700058_121614 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 553
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 235 cgccgccgccaccac 249
>gb|CO512853.1|CO512853 s13dSG20E0400023_121632 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 383
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO512861.1|CO512861 s13dSG20E1200087_121648 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 555
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 191 cgccgccgccaccac 205
>gb|CO512875.1|CO512875 s13dSG20G0500036_121676 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512886.1|CO512886 s13dSG20H0600048_121698 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512895.1|CO512895 s13dSG86A0500033_121716 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 574
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512898.1|CO512898 s13dSG86A1100081_121722 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 594
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512902.1|CO512902 s13dSG86B0400029_121730 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 550
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512919.1|CO512919 s13dSG86D0200014_121764 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 586
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO512920.1|CO512920 s13dSG86D0300026_121766 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 568
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 100 cgccgccgccaccac 114
>gb|CO512930.1|CO512930 s13dSG86E0400023_121786 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 555
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513008.1|CO513008 s13dSG09E0500035_121942 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 598
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513020.1|CO513020 s13dSG09F0900075_121966 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 587
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513034.1|CO513034 s13dSG09H0300028_121994 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 602
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO513042.1|CO513042 s13dSG89A0200005_122010 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 547
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513048.1|CO513048 s13dSG89B0200013_122022 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 555
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513064.1|CO513064 s13dSG89D0100010_122054 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 574
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513080.1|CO513080 s13dSG89E0600039_122086 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 555
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513098.1|CO513098 s13dSG89G1000072_122122 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 544
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513100.1|CO513100 s13dSG89G1200088_122126 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 557
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513111.1|CO513111 s13dSG23A0200005_129386 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 570
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513123.1|CO513123 s13dSG23B0600045_129410 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 591
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 240 cgccgccgccaccac 254
>gb|CO513151.1|CO513151 s13dSG23D1200094_129466 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 576
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513233.1|CO513233 s13dSG24E0700051_129630 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 576
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513237.1|CO513237 s13dSG24E1100083_129638 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 590
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513239.1|CO513239 s13dSG24F0200015_129642 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 555
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513258.1|CO513258 s13dSG24H0100012_129680 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 557
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513289.1|CO513289 s13dSG37C0600038_129742 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 559
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513292.1|CO513292 s13dSG37C0900066_129748 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513293.1|CO513293 s13dSG37C1100082_129750 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 546
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513311.1|CO513311 s13dSG37E0900067_129786 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 543
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO513317.1|CO513317 s13dSG37F0300027_129798 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 526
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513326.1|CO513326 s13dSG37F1200095_129816 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 546
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513335.1|CO513335 s13dSG37G0900068_129834 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 462 cctcggcgccgccgc 476
|||||||||||||||
Sbjct: 78 cctcggcgccgccgc 92
>gb|CO513345.1|CO513345 s13dSG37H0800064_129854 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 578
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513368.1|CO513368 s13dSG38B1100089_129900 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 546
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513377.1|CO513377 s13dSG38C1200086_129918 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 503
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO513388.1|CO513388 s13dSG38E0200007_129940 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 559
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513426.1|CO513426 s13dSG10A0100001_130016 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 547
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513427.1|CO513427 s13dSG10A0300017_130018 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 549
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 239 cgccgccgccaccac 253
>gb|CO513457.1|CO513457 s13dSG10D1000078_130078 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 551
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513511.1|CO513511 s13dSG12C0400022_139804 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 505
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513515.1|CO513515 s13dSG12C0900066_139812 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 600
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513518.1|CO513518 s13dSG12C1200086_139818 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 574
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513524.1|CO513524 s13dSG12D1200094_139830 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 593
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO513572.1|CO513572 s13dSG16A1000069_139926 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 571
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513597.1|CO513597 s13dSG16D0500042_139976 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 561
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513653.1|CO513653 s13dSG17C1000070_140088 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 445
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513670.1|CO513670 s13dSG17E1200087_140122 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 414
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 234 cgccgccgccaccac 248
>gb|CO513681.1|CO513681 s13dSG17G0200008_140144 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 506
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 239 cgccgccgccaccac 253
>gb|CO513693.1|CO513693 s13dSG15A0500033_140168 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 305
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513698.1|CO513698 s13dSG15A1100081_140178 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 291
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513711.1|CO513711 s13dSG15C0200006_140204 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 278
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513748.1|CO513748 s13dSG15F1200095_140278 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 424
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513752.1|CO513752 s13dSG15G0500036_140286 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 420
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513753.1|CO513753 s13dSG15G0600040_140288 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 484
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 238 cgccgccgccaccac 252
>gb|CO513761.1|CO513761 s13dSG15H0600048_140304 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 544
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513786.1|CO513786 s13dSG82E0100003_156234 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 543
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 235 cgccgccgccaccac 249
>gb|CO513817.1|CO513817 s13dSG73A0300017_156296 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513862.1|CO513862 s13dSG73E0200007_156386 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 586
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513878.1|CO513878 s13dSG73F0600047_156418 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 557
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO513881.1|CO513881 s13dSG73F0900075_156424 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 615
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 264 cgccgccgccaccac 278
>gb|CO513902.1|CO513902 s13dSG73H0800064_156466 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 539
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO513988.1|CO513988 s13dSG72A0500033_156638 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 461
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514009.1|CO514009 s13dSG72C0400022_156680 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 526
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514041.1|CO514041 s13dSG72F0300027_156744 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 477
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 240 cgccgccgccaccac 254
>gb|CO514052.1|CO514052 s13dSG72G0500036_156766 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 501
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 235 cgccgccgccaccac 249
>gb|CO514057.1|CO514057 s13dSG72G1000072_156776 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 405
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514064.1|CO514064 s13dSG72H0700060_156790 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 522
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514069.1|CO514069 s13dSG72H1200096_156800 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 510
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514071.1|CO514071 s13dSG75A0200005_156804 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 582
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 462 cctcggcgccgccgc 476
|||||||||||||||
Sbjct: 86 cctcggcgccgccgc 100
>gb|CO514080.1|CO514080 s13dSG75A1200085_156822 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 544
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 261 cgccgccgccaccac 275
>gb|CO514081.1|CO514081 s13dSG75B0100009_156824 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 546
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514119.1|CO514119 s13dSG75E0400023_156900 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 507
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514138.1|CO514138 s13dSG75F1200095_156938 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 544
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514235.1|CO514235 s13dSG76B0300025_157132 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 523
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514242.1|CO514242 s13dSG76B1000077_157146 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 539
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514258.1|CO514258 s13dSG76D0400030_157178 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 507
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514283.1|CO514283 s13dSG76F0600047_157228 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 520
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514293.1|CO514293 s13dSG76G0400024_157248 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 457
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 87 cgccgccgccaccac 101
>gb|CO514304.1|CO514304 s13dSG76H0500044_157270 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 464
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 240 cgccgccgccaccac 254
>gb|CO514434.1|CO514434 s13dSG36F0400041_327528 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 522
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514435.1|CO514435 s13dSG36F0500045_327530 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514436.1|CO514436 s13dSG36F0700061_327532 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 566
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 264 cgccgccgccaccac 278
>gb|CO514445.1|CO514445 s13dSG36G0900070_327550 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 617
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514477.1|CO514477 s13dSG43B0800063_327614 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 637
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514494.1|CO514494 s13dSG43D0600048_327648 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 522
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514496.1|CO514496 s13dSG43D0900076_327652 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 404
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514503.1|CO514503 s13dSG43E0400033_327666 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514521.1|CO514521 s13dSG43G0100006_327702 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 492
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 120 cgccgccgccaccac 134
>gb|CO514540.1|CO514540 s13dSG43H1100094_327740 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 544
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514547.1|CO514547 s13dSG42A0800065_327754 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 594
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514568.1|CO514568 s13dSG42C0800066_327796 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 603
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514571.1|CO514571 s13dSG42C1100086_327802 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 555
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514584.1|CO514584 s13dSG42E0400035_327828 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 615
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514614.1|CO514614 s13dSG42H0500048_327888 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 559
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514686.1|CO514686 s13dSG46H0300032_328032 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 578
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514692.1|CO514692 s13dSG46H1000092_328044 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 521
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514694.1|CO514694 s13dSG46H1200104_328048 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 556
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO514697.1|CO514697 s13dSG55A0400033_328054 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 460
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514797.1|CO514797 s13dSG59C1100086_328254 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 482
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 261 cgccgccgccaccac 275
>gb|CO514865.1|CO514865 s13dSG56C0700054_328390 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 577
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 462 cctcggcgccgccgc 476
|||||||||||||||
Sbjct: 114 cctcggcgccgccgc 128
>gb|CO514875.1|CO514875 s13dSG56D0600058_328410 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514895.1|CO514895 s13dSG56F0700063_328450 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 578
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514916.1|CO514916 s13dSG63A0200017_397337 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 464
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO514941.1|CO514941 s13dSG63C0800066_397387 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 485
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514956.1|CO514956 s13dSG63E0400035_397417 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 484
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO514979.1|CO514979 s13dSG63G1200100_397463 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 276
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 187 cgccgccgccaccac 201
>gb|CO514984.1|CO514984 s13dSG63H0600060_397473 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 496
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO514987.1|CO514987 s13dSG63H1000092_397479 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 499
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 238 cgccgccgccaccac 252
>gb|CO515031.1|CO515031 s13dSG26F0500047_397567 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 472
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515033.1|CO515033 s13dSG26F0700063_397571 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 468
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 264 cgccgccgccaccac 278
>gb|CO515041.1|CO515041 s13dSG26G0900072_397587 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 472
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO515067.1|CO515067 s13dSG97D0500046_397639 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 504
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515085.1|CO515085 s13dSG97H0800076_397675 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 499
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO515093.1|CO515093 s13dSG40A1100085_399051 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 341
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO515113.1|CO515113 s13dSG40D0300030_399091 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 314
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515146.1|CO515146 s13dSG40H0500048_399157 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 339
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO515166.1|CO515166 s13dSG62B0800073_399197 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 496
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515184.1|CO515184 s13dSG62D0400042_399233 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 498
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515190.1|CO515190 s13dSG62D1100094_399245 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 504
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515207.1|CO515207 s13dSG62G0800068_399279 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 494
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 462 cctcggcgccgccgc 476
|||||||||||||||
Sbjct: 103 cctcggcgccgccgc 117
>gb|CO515213.1|CO515213 s13dSG62H0900080_399291 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 485
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO515231.1|CO515231 s13dSG96C0100006_399327 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 451
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515239.1|CO515239 s13dSG96D0600058_399343 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 486
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 264 cgccgccgccaccac 278
>gb|CO515243.1|CO515243 s13dSG96D1000090_399351 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 500
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 234 cgccgccgccaccac 248
>gb|CO515261.1|CO515261 s13dSG96G0700056_399387 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 496
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515317.1|CO515317 s13dSG48E0700055_417693 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 589
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 240 cgccgccgccaccac 254
>gb|CO515328.1|CO515328 s13dSG48F1000091_417715 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 540
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515364.1|CO515364 s13dSG49C0700054_417787 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 590
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO515371.1|CO515371 s13dSG49D0200026_417801 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 336
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO515388.1|CO515388 s13dSG49E1200099_417835 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 571
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515505.1|CO515505 s13dSG52D1000090_418069 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 530
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515566.1|CO515566 s13dSG53G0900072_418191 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 610
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO515603.1|CO515603 s13dSG47D0900078_418265 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 500
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 147 cgccgccgccaccac 161
>gb|CO515604.1|CO515604 s13dSG47D1000090_418267 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 571
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515616.1|CO515616 s13dSG47E1200099_418291 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 561
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 264 cgccgccgccaccac 278
>gb|CO515619.1|CO515619 s13dSG47F1200103_418297 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 465
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO515681.1|CO515681 s13dSG60E0900071_419511 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 570
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515717.1|CO515717 s13dSG77A0700053_419583 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 514
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 258 cgccgccgccaccac 272
>gb|CO515742.1|CO515742 s13dSG77C0900070_419633 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 523
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 238 cgccgccgccaccac 252
>gb|CO515746.1|CO515746 s13dSG77D0200026_419641 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 546
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO515752.1|CO515752 s13dSG77D0800074_419653 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 543
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 242 cgccgccgccaccac 256
>gb|CO515797.1|CO515797 s13dSG54B0500042_421133 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 397
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515807.1|CO515807 s13dSG54C0700052_421153 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 524
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO515844.1|CO515844 s13dSG54G0200008_421227 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 393
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515867.1|CO515867 s13dSG91A0700051_421273 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 521
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515963.1|CO515963 s13dSG61D0100010_445254 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 304
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 234 cgccgccgccaccac 248
>gb|CO515968.1|CO515968 s13dSG61D0700062_445264 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 503
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515977.1|CO515977 s13dSG61E0400033_445282 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 400
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515979.1|CO515979 s13dSG61E0600051_445286 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515985.1|CO515985 s13dSG61E1200099_445298 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 508
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO515994.1|CO515994 s13dSG61F1000091_445316 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 523
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO516089.1|CO516089 s13dSG65B0200013_445506 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 521
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516095.1|CO516095 s13dSG65B1100093_445518 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 569
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516097.1|CO516097 s13dSG65C0100002_445522 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 390
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO516099.1|CO516099 s13dSG65C0400024_445526 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 296
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO516102.1|CO516102 s13dSG65C0900070_445532 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 503
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516118.1|CO516118 s13dSG65E1000083_445564 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 498
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 213 cgccgccgccaccac 227
>gb|CO516126.1|CO516126 s13dSG65F1000091_445580 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 570
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516138.1|CO516138 s13dSG65G1200100_445604 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 564
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 230 cgccgccgccaccac 244
>gb|CO516242.1|CO516242 s13dSG69B0500042_445812 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 541
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO516243.1|CO516243 s13dSG69B0600046_445814 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 535
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516244.1|CO516244 s13dSG69B0700059_445816 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 523
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 264 cgccgccgccaccac 278
>gb|CO516300.1|CO516300 s13dSG69G0500037_445928 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 530
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 264 cgccgccgccaccac 278
>gb|CO516435.1|CO516435 s13dSG27G0900070_446198 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 521
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516467.1|CO516467 s13dSG28C0600040_446262 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 469
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO516482.1|CO516482 s13dSG28D1100092_446292 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 537
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 234 cgccgccgccaccac 248
>gb|CO516578.1|CO516578 s13dSG57G1100086_446484 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 540
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516594.1|CO516594 s13dSG66A0700051_446516 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 525
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO516600.1|CO516600 s13dSG66B0200013_446528 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 476
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516626.1|CO516626 s13dSG66D0800064_446580 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 525
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO516631.1|CO516631 s13dSG66E0100003_446590 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 411
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516673.1|CO516673 s13dSG74A0500034_446674 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 467
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516684.1|CO516684 s13dSG74B0500042_446696 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 540
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516728.1|CO516728 s13dSG74F0600057_446784 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 526
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 243 cgccgccgccaccac 257
>gb|CO516747.1|CO516747 s13dSG74H0500045_446822 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 542
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516759.1|CO516759 s13dSG94A0900067_446846 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 503
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516766.1|CO516766 s13dSG94B0600046_446860 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 535
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 236 cgccgccgccaccac 250
>gb|CO516797.1|CO516797 s13dSG94F0700061_446922 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 521
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516819.1|CO516819 s13dSG98B0400029_446966 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 417
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 241 cgccgccgccaccac 255
>gb|CO516845.1|CO516845 s13dSG98D1200102_447018 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 530
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 233 cgccgccgccaccac 247
>gb|CO516892.1|CO516892 s13dSG58B0600046_468330 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 520
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
>gb|CO516923.1|CO516923 s13dSG58E0600049_468392 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 514
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 468 cgccgccgccaccac 482
|||||||||||||||
Sbjct: 237 cgccgccgccaccac 251
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: May 2, 2006 2:40 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2639
Number of Sequences: 7669
Number of extensions: 2639
Number of successful extensions: 906
Number of sequences better than 10.0: 263
Number of HSP's better than 10.0 without gapping: 263
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 634
Number of HSP's gapped (non-prelim): 272
length of query: 1986
length of database: 3,745,706
effective HSP length: 17
effective length of query: 1969
effective length of database: 3,615,333
effective search space: 7118590677
effective search space used: 7118590677
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)