BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 44956.2.1
(1252 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AA735030.1|AA735030 EST00010 young root nodules Medicago... 54 2e-007
gb|CO514339.1|CO514339 s13dSG84C1200086_157340 Glandular tr... 34 0.23
emb|AJ409163.1|MSA409163 Medicago sativa mRNA for ZR1 protein 34 0.23
>gb|AA735030.1|AA735030 EST00010 young root nodules Medicago sativa subsp. x varia cDNA
clone Mscp14 5' similar to 3-oxoacyl-(acyl carrier
protein) reductase homologue, mRNA sequence
Length = 416
Score = 54.0 bits (27), Expect = 2e-007
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 366 ggcagtcatatcagatgcaatgaaccctggtgcaatagcattcacattgat 416
||||||||| |||||||||||||| ||||| |||| |||||| ||| ||||
Sbjct: 158 ggcagtcatgtcagatgcaatgaatcctggagcaacagcattaacagtgat 108
>gb|CO514339.1|CO514339 s13dSG84C1200086_157340 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 534
Score = 34.2 bits (17), Expect = 0.23
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 545 cctttctctttttcatc 561
|||||||||||||||||
Sbjct: 104 cctttctctttttcatc 88
>emb|AJ409163.1|MSA409163 Medicago sativa mRNA for ZR1 protein
Length = 3108
Score = 34.2 bits (17), Expect = 0.23
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 957 tacaattgcttgttcaacagc 977
||||||||| |||||||||||
Sbjct: 69 tacaattgcctgttcaacagc 49
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4056
Number of Sequences: 7669
Number of extensions: 4056
Number of successful extensions: 1249
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1245
Number of HSP's gapped (non-prelim): 4
length of query: 1252
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1236
effective length of database: 3,623,002
effective search space: 4478030472
effective search space used: 4478030472
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)