BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3848982.2.1
(697 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO513105.1|CO513105 s13dSG89H0600048_122136 Glandular tr... 32 0.50
gb|CO515323.1|CO515323 s13dSG48F0400043_417705 Glandular tr... 32 0.50
gb|AF439380.1| Medicago sativa retrotransposon polyprotein ... 32 0.50
>gb|CO513105.1|CO513105 s13dSG89H0600048_122136 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 588
Score = 32.2 bits (16), Expect = 0.50
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 538 atgcatgcatatatga 553
||||||||||||||||
Sbjct: 222 atgcatgcatatatga 207
>gb|CO515323.1|CO515323 s13dSG48F0400043_417705 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 319
Score = 32.2 bits (16), Expect = 0.50
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 536 agatgcatgcatatat 551
||||||||||||||||
Sbjct: 177 agatgcatgcatatat 162
>gb|AF439380.1| Medicago sativa retrotransposon polyprotein gene interrupted by LTR
retroelement MCIRE, complete sequence
Length = 18789
Score = 32.2 bits (16), Expect = 0.50
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 649 atatatataataatgcaagc 668
||||||||||||| ||||||
Sbjct: 12789 atatatataataaagcaagc 12770
Score = 32.2 bits (16), Expect = 0.50
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 649 atatatataataatgcaagc 668
||||||||||||| ||||||
Sbjct: 8731 atatatataataaagcaagc 8712
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 809
Number of Sequences: 7669
Number of extensions: 809
Number of successful extensions: 199
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 195
Number of HSP's gapped (non-prelim): 4
length of query: 697
length of database: 3,745,706
effective HSP length: 16
effective length of query: 681
effective length of database: 3,623,002
effective search space: 2467264362
effective search space used: 2467264362
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)