BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3748394.2.2
(3527 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY851389.1| Medicago sativa leaf sucrose-phosphate synth... 109 1e-023
gb|AF322116.2|AF322116 Medicago sativa sucrose-phosphate sy... 48 4e-005
gb|AY468362.2| Medicago sativa sucrose-phosphate synthase g... 42 0.003
>gb|AY851389.1| Medicago sativa leaf sucrose-phosphate synthase mRNA, partial cds
Length = 645
Score = 109 bits (55), Expect = 1e-023
Identities = 118/139 (84%)
Strand = Plus / Plus
Query: 1053 gccttacgtgatacatgggcactatgccgatgctggagatgttgctgctctcctttctgg 1112
|||||| ||||| ||||| |||||||| |||||||| || ||||||||| ||||| ||
Sbjct: 380 gccttatgtgattcatggacactatgctgatgctggtgacagtgctgctcttctttcagg 439
Query: 1113 tgcgctgaatgtgccaatggtgctcactggccactcacttgggaggaacaagctggaaca 1172
||| |||||||||||||||| |||||||| || |||||||| || ||||| || |||||
Sbjct: 440 tgctttgaatgtgccaatggttctcactggtcattcacttggaagaaacaaacttgaaca 499
Query: 1173 actgctgaagcaagggcgc 1191
||| || ||||||||||||
Sbjct: 500 acttcttaagcaagggcgc 518
Score = 50.1 bits (25), Expect = 1e-005
Identities = 52/61 (85%)
Strand = Plus / Plus
Query: 683 acatggaactaggtcgtgattctgatacaggtggccaggtgaaatatgtggtcgaacttg 742
||||||| || ||| | ||||||||||| ||||| ||| | ||||||||||| |||||||
Sbjct: 1 acatggagcttggtagagattctgatactggtggacagattaaatatgtggtagaacttg 60
Query: 743 c 743
|
Sbjct: 61 c 61
>gb|AF322116.2|AF322116 Medicago sativa sucrose-phosphate synthase mRNA, complete cds
Length = 3579
Score = 48.1 bits (24), Expect = 4e-005
Identities = 84/104 (80%)
Strand = Plus / Plus
Query: 1597 agaccagacccgaagaagaacatcactaccctcgtcaaagcgtttggagagtgtcgtcca 1656
|||||||| || |||||||||||||| || | || ||||| |||||||| || |||||
Sbjct: 1589 agaccagatcctaagaagaacatcacaactttggtgaaagcatttggagaatgccgtcct 1648
Query: 1657 ctcagggaacttgcaaaccttactctgatcatgggtaacagaga 1700
|| || || ||||| |||||||| | || ||||||||| ||||
Sbjct: 1649 cttagagagcttgctaaccttacattaattatgggtaaccgaga 1692
Score = 40.1 bits (20), Expect = 0.010
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 1852 aagggcgtcttcatcaaccctgctctcgttgagccgtttggtct 1895
||||| |||||| |||| |||||| || |||| |||||||||||
Sbjct: 1844 aagggtgtcttcgtcaatcctgctatcattgaaccgtttggtct 1887
Score = 40.1 bits (20), Expect = 0.010
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 700 gattctgatacaggtggccaggtgaaatatgtggtcgaacttgc 743
||||||||||| ||||| ||||| || ||||| || ||||||||
Sbjct: 701 gattctgatacgggtggtcaggttaagtatgtcgtggaacttgc 744
Score = 36.2 bits (18), Expect = 0.16
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 1757 tgattgacaagtatgatctgta 1778
||||||||||||| ||||||||
Sbjct: 1749 tgattgacaagtacgatctgta 1770
>gb|AY468362.2| Medicago sativa sucrose-phosphate synthase gene, promoter region and
complete cds
Length = 8933
Score = 42.1 bits (21), Expect = 0.003
Identities = 66/81 (81%)
Strand = Plus / Plus
Query: 1597 agaccagacccgaagaagaacatcactaccctcgtcaaagcgtttggagagtgtcgtcca 1656
|||||||| || |||||||||||||| || | || ||||| |||||||| || |||||
Sbjct: 5174 agaccagatcctaagaagaacatcacaactttggtgaaagcatttggagaatgccgtcct 5233
Query: 1657 ctcagggaacttgcaaacctt 1677
|| || || ||||| ||||||
Sbjct: 5234 cttagagagcttgctaacctt 5254
Score = 38.2 bits (19), Expect = 0.041
Identities = 37/43 (86%)
Strand = Plus / Plus
Query: 1853 agggcgtcttcatcaaccctgctctcgttgagccgtttggtct 1895
|||| |||||| |||| |||||| || |||| |||||||||||
Sbjct: 6637 agggtgtcttcgtcaatcctgctatcattgaaccgtttggtct 6679
Score = 36.2 bits (18), Expect = 0.16
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 1757 tgattgacaagtatgatctgta 1778
||||||||||||| ||||||||
Sbjct: 5452 tgattgacaagtacgatctgta 5473
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5885
Number of Sequences: 7669
Number of extensions: 5885
Number of successful extensions: 1873
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1857
Number of HSP's gapped (non-prelim): 16
length of query: 3527
length of database: 3,745,706
effective HSP length: 17
effective length of query: 3510
effective length of database: 3,615,333
effective search space: 12689818830
effective search space used: 12689818830
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)