BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3588987.2.1
(487 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AJ410118.1|AJ410118 AJ410118 Medicago sativa library (Ka... 36 0.022
gb|AF512999.1| Medicago sativa TPR1 (tpr1) mRNA, complete cds 36 0.022
>gb|AJ410118.1|AJ410118 AJ410118 Medicago sativa library (Kalo P) Medicago sativa cDNA
clone U380, mRNA sequence
Length = 672
Score = 36.2 bits (18), Expect = 0.022
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 52 gatcattaacagccatgaccaa 73
|||||||| |||||||||||||
Sbjct: 113 gatcattaccagccatgaccaa 92
>gb|AF512999.1| Medicago sativa TPR1 (tpr1) mRNA, complete cds
Length = 1264
Score = 36.2 bits (18), Expect = 0.022
Identities = 54/66 (81%)
Strand = Plus / Minus
Query: 180 tacttcatctgaactatccctgcgctgacgagcttctggatcttctgcatcactccgggg 239
||||||||||| || || || || |||| ||||| |||||||| | |||||| || |||
Sbjct: 1049 tacttcatctggacaattccggcactgatcagcttttggatcttgtccatcacacccggg 990
Query: 240 ttcttg 245
||||||
Sbjct: 989 ttcttg 984
Score = 34.2 bits (17), Expect = 0.087
Identities = 26/29 (89%)
Strand = Plus / Minus
Query: 315 aggatgttctggatctcagggtcttgcat 343
||||||||||| ||||| || ||||||||
Sbjct: 914 aggatgttctgaatctctggatcttgcat 886
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 887
Number of Sequences: 7669
Number of extensions: 887
Number of successful extensions: 306
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 303
Number of HSP's gapped (non-prelim): 3
length of query: 487
length of database: 3,745,706
effective HSP length: 16
effective length of query: 471
effective length of database: 3,623,002
effective search space: 1706433942
effective search space used: 1706433942
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)