BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3204398.2.1
(666 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|Y11348.1|MSNANN M.sativa mRNA for annexin-like protein 64 1e-010
gb|CO517275.1|CO517275 s13dSG32H1100096_486146 Glandular tr... 52 5e-007
>emb|Y11348.1|MSNANN M.sativa mRNA for annexin-like protein
Length = 1533
Score = 63.9 bits (32), Expect = 1e-010
Identities = 95/116 (81%)
Strand = Plus / Plus
Query: 55 ccagcaaagtattttgcaaagctcttacgaaaggccatgaaaggtctaggcactgatgac 114
||||||||||||||||||||| | || ||||| ||||||||| |||| ||| ||||
Sbjct: 836 ccagcaaagtattttgcaaaggtgttgtataaggcaatgaaaggtttagggactaatgat 895
Query: 115 aagacacttataagggttgtggtgacgaggactgaaattgatatgcaatatatcaa 170
| ||||| |||||||| | || || |||||||| ||||||||||| ||||||||
Sbjct: 896 agcacactcataagggtcattgtaacaaggactgagattgatatgcagtatatcaa 951
>gb|CO517275.1|CO517275 s13dSG32H1100096_486146 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 628
Score = 52.0 bits (26), Expect = 5e-007
Identities = 62/74 (83%)
Strand = Plus / Minus
Query: 58 gcaaagtattttgcaaagctcttacgaaaggccatgaaaggtctaggcactgatgacaag 117
||||||||||| |||||| || |||| | ||| ||||||||||| || || ||||||| |
Sbjct: 544 gcaaagtatttcgcaaaggtcctacgtagggcaatgaaaggtctggggaccgatgacacg 485
Query: 118 acacttataagggt 131
| |||||| |||||
Sbjct: 484 aaacttatgagggt 471
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1300
Number of Sequences: 7669
Number of extensions: 1300
Number of successful extensions: 338
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 334
Number of HSP's gapped (non-prelim): 3
length of query: 666
length of database: 3,745,706
effective HSP length: 16
effective length of query: 650
effective length of database: 3,623,002
effective search space: 2354951300
effective search space used: 2354951300
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)