BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3199064.2.1
(589 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO515699.1|CO515699 s13dSG60G0600052_419547 Glandular tr... 56 3e-008
gb|CO514282.1|CO514282 s13dSG76F0500043_157226 Glandular tr... 54 1e-007
gb|DQ122788.1| Medicago sativa clone B11 sucrose synthase m... 54 1e-007
gb|AF049487.1|AF049487 Medicago sativa sucrose synthase mRN... 48 7e-006
gb|CO514465.1|CO514465 s13dSG43A0700051_327590 Glandular tr... 32 0.42
>gb|CO515699.1|CO515699 s13dSG60G0600052_419547 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 449
Score = 56.0 bits (28), Expect = 3e-008
Identities = 31/32 (96%)
Strand = Plus / Plus
Query: 276 ctgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||| ||||||||||||||||||||
Sbjct: 180 ctgagggagctagtaaaccttgtcgtcgttgc 211
>gb|CO514282.1|CO514282 s13dSG76F0500043_157226 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 515
Score = 54.0 bits (27), Expect = 1e-007
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 183 gaccggtcaaagcccatcctcttctccatggcaagactcgacagggtgaagaacataac 241
|||||||||||||| || |||||||||||||||| || ||||| || || ||||||||
Sbjct: 58 gaccggtcaaagcctataatcttctccatggcaaggcttgacagagttaaaaacataac 116
>gb|DQ122788.1| Medicago sativa clone B11 sucrose synthase mRNA, partial cds
Length = 536
Score = 54.0 bits (27), Expect = 1e-007
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 183 gaccggtcaaagcccatcctcttctccatggcaagactcgacagggtgaagaacataac 241
|||||||||||||| || |||||||||||||||| || ||||| || || ||||||||
Sbjct: 20 gaccggtcaaagcctataatcttctccatggcaaggcttgacagagttaaaaacataac 78
>gb|AF049487.1|AF049487 Medicago sativa sucrose synthase mRNA, complete cds
Length = 2760
Score = 48.1 bits (24), Expect = 7e-006
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 21 gatgtcttcgatccaaagttcaatatagtctctcctggagctga 64
|||||||| |||||||||||||| || || ||||| ||||||||
Sbjct: 1598 gatgtctttgatccaaagttcaacattgtatctccaggagctga 1641
>gb|CO514465.1|CO514465 s13dSG43A0700051_327590 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 459
Score = 32.2 bits (16), Expect = 0.42
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 425 ttggtttaggtatatc 440
||||||||||||||||
Sbjct: 99 ttggtttaggtatatc 114
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 830
Number of Sequences: 7669
Number of extensions: 830
Number of successful extensions: 206
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 198
Number of HSP's gapped (non-prelim): 8
length of query: 589
length of database: 3,745,706
effective HSP length: 16
effective length of query: 573
effective length of database: 3,623,002
effective search space: 2075980146
effective search space used: 2075980146
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)