BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3067375.2.1
         (1829 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CO516275.1|CO516275  s13dSG69E0200007_445878 Glandular tr...    36   0.084
>gb|CO516275.1|CO516275 s13dSG69E0200007_445878 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 415

 Score = 36.2 bits (18), Expect = 0.084
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 572 tctattaataacaaaatagatt 593
           ||||||||||||||||| ||||
Sbjct: 34  tctattaataacaaaatggatt 13
  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4697
Number of Sequences: 7669
Number of extensions: 4697
Number of successful extensions: 1358
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1357
Number of HSP's gapped (non-prelim): 1
length of query: 1829
length of database: 3,745,706
effective HSP length: 17
effective length of query: 1812
effective length of database: 3,615,333
effective search space: 6550983396
effective search space used: 6550983396
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)