BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2622915.2.1
         (584 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AW698672.1|AW698672  R103 non-glandular-haired subtracted...    34   0.10 
gb|CO512959.1|CO512959  s13dSG86H0300028_121844 Glandular tr...    34   0.10 
gb|CO513469.1|CO513469  s13dSG10F0200015_130102 Glandular tr...    34   0.10 
gb|CO516824.1|CO516824  s13dSG98B0900075_446976 Glandular tr...    34   0.10 
gb|CO514711.1|CO514711  s13dSG55C0100006_328082 Glandular tr...    32   0.41 

>gb|AW698672.1|AW698672 R103 non-glandular-haired subtracted cDNA library Medicago sativa
           cDNA, mRNA sequence
          Length = 251

 Score = 34.2 bits (17), Expect = 0.10
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 261 attcttcttcttcactt 277
           |||||||||||||||||
Sbjct: 156 attcttcttcttcactt 140



>gb|CO512959.1|CO512959 s13dSG86H0300028_121844 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 570

 Score = 34.2 bits (17), Expect = 0.10
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 113 aaacacagagaaatcaacatc 133
           ||||||||||||| |||||||
Sbjct: 75  aaacacagagaaagcaacatc 95



>gb|CO513469.1|CO513469 s13dSG10F0200015_130102 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 583

 Score = 34.2 bits (17), Expect = 0.10
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 258 cagattcttcttcttca 274
           |||||||||||||||||
Sbjct: 90  cagattcttcttcttca 106



>gb|CO516824.1|CO516824 s13dSG98B0900075_446976 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 462

 Score = 34.2 bits (17), Expect = 0.10
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 258 cagattcttcttcttca 274
           |||||||||||||||||
Sbjct: 94  cagattcttcttcttca 110



>gb|CO514711.1|CO514711 s13dSG55C0100006_328082 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 449

 Score = 32.2 bits (16), Expect = 0.41
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                           
Query: 258 cagattcttcttcttc 273
           ||||||||||||||||
Sbjct: 90  cagattcttcttcttc 105



  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1584
Number of Sequences: 7669
Number of extensions: 1584
Number of successful extensions: 590
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 584
Number of HSP's gapped (non-prelim): 6
length of query: 584
length of database: 3,745,706
effective HSP length: 16
effective length of query: 568
effective length of database: 3,623,002
effective search space: 2057865136
effective search space used: 2057865136
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)