BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2494085.2.4
(645 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO512814.1|CO512814 s13dSG20A0800053_121554 Glandular tr... 34 0.12
gb|CO512083.1|CO512083 s13dSG18F0700059_108486 Glandular tr... 32 0.46
gb|CO512213.1|CO512213 s13dSG03D0100010_113940 Glandular tr... 32 0.46
>gb|CO512814.1|CO512814 s13dSG20A0800053_121554 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 602
Score = 34.2 bits (17), Expect = 0.12
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 543 ggaatggaatggagagt 559
|||||||||||||||||
Sbjct: 29 ggaatggaatggagagt 45
>gb|CO512083.1|CO512083 s13dSG18F0700059_108486 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 593
Score = 32.2 bits (16), Expect = 0.46
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 163 atttaatattttaatt 178
||||||||||||||||
Sbjct: 299 atttaatattttaatt 284
>gb|CO512213.1|CO512213 s13dSG03D0100010_113940 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 576
Score = 32.2 bits (16), Expect = 0.46
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 538 ggaacggaatggaatggaga 557
|||| |||||||||||||||
Sbjct: 55 ggaaaggaatggaatggaga 36
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1107
Number of Sequences: 7669
Number of extensions: 1107
Number of successful extensions: 389
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 385
Number of HSP's gapped (non-prelim): 4
length of query: 645
length of database: 3,745,706
effective HSP length: 16
effective length of query: 629
effective length of database: 3,623,002
effective search space: 2278868258
effective search space used: 2278868258
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)