BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2494085.2.4
         (645 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CO512814.1|CO512814  s13dSG20A0800053_121554 Glandular tr...    34   0.12 
gb|CO512083.1|CO512083  s13dSG18F0700059_108486 Glandular tr...    32   0.46 
gb|CO512213.1|CO512213  s13dSG03D0100010_113940 Glandular tr...    32   0.46 
>gb|CO512814.1|CO512814 s13dSG20A0800053_121554 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 602

 Score = 34.2 bits (17), Expect = 0.12
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 543 ggaatggaatggagagt 559
           |||||||||||||||||
Sbjct: 29  ggaatggaatggagagt 45
>gb|CO512083.1|CO512083 s13dSG18F0700059_108486 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 593

 Score = 32.2 bits (16), Expect = 0.46
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                           
Query: 163 atttaatattttaatt 178
           ||||||||||||||||
Sbjct: 299 atttaatattttaatt 284
>gb|CO512213.1|CO512213 s13dSG03D0100010_113940 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 576

 Score = 32.2 bits (16), Expect = 0.46
 Identities = 19/20 (95%)
 Strand = Plus / Minus

                               
Query: 538 ggaacggaatggaatggaga 557
           |||| |||||||||||||||
Sbjct: 55  ggaaaggaatggaatggaga 36
  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1107
Number of Sequences: 7669
Number of extensions: 1107
Number of successful extensions: 389
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 385
Number of HSP's gapped (non-prelim): 4
length of query: 645
length of database: 3,745,706
effective HSP length: 16
effective length of query: 629
effective length of database: 3,623,002
effective search space: 2278868258
effective search space used: 2278868258
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)