BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2485944.3.1
         (991 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AF083333.1|AF083333  Medicago sativa cinnamyl-alcohol deh...    36   0.046
gb|L46856.1|ALFCAD1A  Medicago sativa cinnamyl-alcohol dehyd...    36   0.046

>gb|AF083333.1|AF083333 Medicago sativa cinnamyl-alcohol dehydrogenase (MsaCad1) mRNA,
           complete cds
          Length = 1390

 Score = 36.2 bits (18), Expect = 0.046
 Identities = 39/46 (84%)
 Strand = Plus / Plus

                                                         
Query: 945 aaatttggtaaagcatttggtcttaaggtcacagttttcagtacct 990
           ||||| |||||||||||||| || ||||| || ||| | |||||||
Sbjct: 699 aaattcggtaaagcatttgggctgaaggttactgttattagtacct 744



>gb|L46856.1|ALFCAD1A Medicago sativa cinnamyl-alcohol dehydrogenase (cad1) mRNA,
           complete cds
          Length = 1390

 Score = 36.2 bits (18), Expect = 0.046
 Identities = 39/46 (84%)
 Strand = Plus / Plus

                                                         
Query: 945 aaatttggtaaagcatttggtcttaaggtcacagttttcagtacct 990
           ||||| |||||||||||||| || ||||| || ||| | |||||||
Sbjct: 699 aaattcggtaaagcatttgggctgaaggttactgttattagtacct 744



  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1587
Number of Sequences: 7669
Number of extensions: 1587
Number of successful extensions: 485
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 479
Number of HSP's gapped (non-prelim): 6
length of query: 991
length of database: 3,745,706
effective HSP length: 16
effective length of query: 975
effective length of database: 3,623,002
effective search space: 3532426950
effective search space used: 3532426950
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)