BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2455940.2.1
(1115 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|U20736.1|MSU20736 Medicago sativa S-adenosyl-L-methionin... 52 9e-007
emb|AX259371.1| Sequence 1 from Patent WO0173090 52 9e-007
emb|CQ760958.1| Sequence 3 from Patent WO2004002216 52 9e-007
emb|CQ760964.1| Sequence 9 from Patent WO2004002216 52 9e-007
gb|CO512917.1|CO512917 s13dSG86C1100082_121760 Glandular tr... 34 0.20
>gb|U20736.1|MSU20736 Medicago sativa S-adenosyl-L-methionine:trans-caffeoyl-CoA
3-O-methyltransferase (CCOMT) mRNA, complete cds
Length = 966
Score = 52.0 bits (26), Expect = 9e-007
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 325 gtggcaaggagggagtagccagtgtagacaccaatttccatggtattctt 276
Score = 38.2 bits (19), Expect = 0.013
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 477 tggtagttgaggtagttgtccttgtcggcgtccac 511
|||||||||||||| ||||| ||||| || |||||
Sbjct: 553 tggtagttgaggtaattgtctttgtcagcatccac 519
>emb|AX259371.1| Sequence 1 from Patent WO0173090
Length = 744
Score = 52.0 bits (26), Expect = 9e-007
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 290 gtggcaaggagggagtagccagtgtagacaccaatttccatggtattctt 241
Score = 38.2 bits (19), Expect = 0.013
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 477 tggtagttgaggtagttgtccttgtcggcgtccac 511
|||||||||||||| ||||| ||||| || |||||
Sbjct: 518 tggtagttgaggtaattgtctttgtcagcatccac 484
>emb|CQ760958.1| Sequence 3 from Patent WO2004002216
Length = 744
Score = 52.0 bits (26), Expect = 9e-007
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 290 gtggcaaggagggagtagccagtgtagacaccaatttccatggtattctt 241
Score = 38.2 bits (19), Expect = 0.013
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 477 tggtagttgaggtagttgtccttgtcggcgtccac 511
|||||||||||||| ||||| ||||| || |||||
Sbjct: 518 tggtagttgaggtaattgtctttgtcagcatccac 484
>emb|CQ760964.1| Sequence 9 from Patent WO2004002216
Length = 1906
Score = 52.0 bits (26), Expect = 9e-007
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 705 gtggcgaggagggagtagccggtgtagacgccgatctccatggtcttctt 754
||||| |||||||||||||| |||||||| || || |||||||| |||||
Sbjct: 1265 gtggcaaggagggagtagccagtgtagacaccaatttccatggtattctt 1216
Score = 38.2 bits (19), Expect = 0.013
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 477 tggtagttgaggtagttgtccttgtcggcgtccac 511
|||||||||||||| ||||| ||||| || |||||
Sbjct: 1493 tggtagttgaggtaattgtctttgtcagcatccac 1459
>gb|CO512917.1|CO512917 s13dSG86C1100082_121760 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 323
Score = 34.2 bits (17), Expect = 0.20
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 474 tcgtggtagttgaggta 490
|||||||||||||||||
Sbjct: 241 tcgtggtagttgaggta 257
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1339
Number of Sequences: 7669
Number of extensions: 1339
Number of successful extensions: 405
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 388
Number of HSP's gapped (non-prelim): 17
length of query: 1115
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1099
effective length of database: 3,623,002
effective search space: 3981679198
effective search space used: 3981679198
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)