BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2448385.2.9
(708 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO512950.1|CO512950 s13dSG86G0500036_121826 Glandular tr... 246 2e-065
>gb|CO512950.1|CO512950 s13dSG86G0500036_121826 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 600
Score = 246 bits (124), Expect = 2e-065
Identities = 277/328 (84%)
Strand = Plus / Plus
Query: 196 aatgagtggaaaaaaccttttgctggatcatctcacgccaagggcatcgttctggagaag 255
||||| ||||| ||||| ||| |||| ||||| || || ||||| || ||||| || |||
Sbjct: 183 aatgaatggaagaaacccttttctggttcatcccatgctaagggaattgttcttgaaaag 242
Query: 256 attggtattgaggccaagcagccaaattcggccatccgtaagtgtgcccgtgttcagctg 315
|||||||||||||| |||||||| || || ||||| ||||||||||| | ||||| |
Sbjct: 243 attggtattgaggctaagcagcccaactctgccattcgtaagtgtgctagggttcaatta 302
Query: 316 gtgaagaatggaaagaagattgctgcctttgtgccgaatgatggttgcctaaactacatc 375
| || ||||| |||||||||||||||||||| || |||||||||||| | || |||||
Sbjct: 303 atcaaaaatgggaagaagattgctgcctttgtcccaaatgatggttgcttgaattacatt 362
Query: 376 gaggagaatgatgaggtgttgattgctggatttggtcgtaagggtcatgctgtgggagac 435
|||||||||||||| || ||||| ||||||||||| ||||| ||||||||||| || ||
Sbjct: 363 gaggagaatgatgaagtcttgatcgctggatttggacgtaaaggtcatgctgttggtgat 422
Query: 436 attcctggtgtcaggttcaaggttgttaaggtgtctggtgtgtcgctgcttgcactcttc 495
|||||||| |||||||||||||| || ||||| |||||||| || || ||||| || |||
Sbjct: 423 attcctggagtcaggttcaaggtcgtgaaggtttctggtgtctctctacttgctcttttc 482
Query: 496 aaggagaagaaggagaagccaaggtctt 523
|||||||||||||||||||| |||||||
Sbjct: 483 aaggagaagaaggagaagcctaggtctt 510
Score = 44.1 bits (22), Expect = 1e-004
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 93 caccatggggaagacacgtggtatgggagctgggcgcaagct 134
|||||||||||||||| | || |||||||||| ||||||||
Sbjct: 80 caccatggggaagacaagaggaatgggagctgctcgcaagct 121
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1670
Number of Sequences: 7669
Number of extensions: 1670
Number of successful extensions: 471
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 468
Number of HSP's gapped (non-prelim): 3
length of query: 708
length of database: 3,745,706
effective HSP length: 16
effective length of query: 692
effective length of database: 3,623,002
effective search space: 2507117384
effective search space used: 2507117384
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)