BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2440570.2.2
(905 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY205233.1| Medicago sativa 60S ribosomal protein mRNA, ... 52 7e-007
>gb|AY205233.1| Medicago sativa 60S ribosomal protein mRNA, partial cds
Length = 544
Score = 52.0 bits (26), Expect = 7e-007
Identities = 134/170 (78%)
Strand = Plus / Plus
Query: 371 gcaatgaaggttactgccctgaggttcacggagacagcaagggccaggattgtcaatgct 430
||||| ||||| ||||| || |||||||| || | || ||||| || |||| || |||
Sbjct: 337 gcaattaaggtaactgctctaaggttcaccgaaaaggccagggctagaattgagaaggct 396
Query: 431 ggtggcgagtgcctcacatttgaccagcttgctcttcgtgctccacttggcgagaacacg 490
||||| ||||||||||| ||||| ||||| |||||| ||||| | || ||||||||
Sbjct: 397 ggtggggagtgcctcacctttgatcagctggctcttaaagctcctttagggcagaacacg 456
Query: 491 gtcctcttgaggggccccaagaatgcccgtgaggcagtgaggcactttgg 540
|| || | || || ||||| |||||||||||||| || | |||||||||
Sbjct: 457 gttcttcttagaggtcccaaaaatgcccgtgaggctgtcaagcactttgg 506
Score = 46.1 bits (23), Expect = 4e-005
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 156 tctacctcaagctcctcgtcaagctctaccgtttc 190
||||||||||||| ||||| ||||| |||||||||
Sbjct: 122 tctacctcaagcttctcgttaagctataccgtttc 156
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1837
Number of Sequences: 7669
Number of extensions: 1837
Number of successful extensions: 427
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 423
Number of HSP's gapped (non-prelim): 4
length of query: 905
length of database: 3,745,706
effective HSP length: 16
effective length of query: 889
effective length of database: 3,623,002
effective search space: 3220848778
effective search space used: 3220848778
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)