BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419155.2.3
(1354 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|X70707.1|MSCDC2 M.sativa mRNA for CDC2 kinase 182 4e-046
gb|M58365.1|ALFPKSTA Medicago sativa CDC2MS serine/threonin... 168 7e-042
gb|AF302013.1| Medicago sativa subsp. x varia CDK-activatin... 38 0.016
>emb|X70707.1|MSCDC2 M.sativa mRNA for CDC2 kinase
Length = 1308
Score = 182 bits (92), Expect = 4e-046
Identities = 341/424 (80%)
Strand = Plus / Plus
Query: 585 ttgcgtactgccattctcatagagttcttcaccgagatttgaaacctcagaacttattga 644
|||| ||||| |||||||||||||||||||| |||| |||||||| ||||| | |||
Sbjct: 413 ttgcttactgtcattctcatagagttcttcatagagacttgaaaccacagaatctgctga 472
Query: 645 tagatcggcgcactaatgcactgaagcttgcagactttggtttagccagggcatttggaa 704
| ||||| || ||||||| | ||||||||||| ||||| || ||||||||||||||||
Sbjct: 473 ttgatcgcagctctaatgccgtaaagcttgcagattttggattggccagggcatttggaa 532
Query: 705 ttcctgtccgtacatttactcatgaggtagtgacattatggtacagagctccagaaattc 764
|||||||| | |||||||| |||||||| |||||| | ||||||||||||||||||||
Sbjct: 533 ttcctgtcaggacatttacacatgaggtggtgacactctggtacagagctccagaaatat 592
Query: 765 tgcttggagcgaggcagtattccacaccagttgatgtgtggtctgtgggctgtatctttg 824
||||||| | | || ||||| || || |||||||| ||||| ||||| || || ||||
Sbjct: 593 tgcttgggtctcgtcattattctaccccggttgatgtctggtcagtgggatgcatatttg 652
Query: 825 cggaaatggtgaaccaaaagccactattccctggcgattctgagatcgacgaacttttta 884
| || ||| | |||||| |||||| ||||| || || |||||||| || ||| | ||||
Sbjct: 653 cagagatgataaaccaacggccacttttcccaggggactctgagattgatgaattgttta 712
Query: 885 agatattcaggatactaggtacaccgaatgagcagagttggccaggagtcagttgtttgc 944
| |||||||| || ||||||||||||||| | | ||||| ||||| | || ||||
Sbjct: 713 aaatattcagaatcacgggtacaccgaatgaggaaacatggcctggagtgacttcattgc 772
Query: 945 ctgacttcaagacagctttccccaggtggcaagctcaggacctggcaacagtagtcccaa 1004
|||| || || |||| || |||| ||||| |||| ||||||||||||| ||||||||
Sbjct: 773 ctgattttaaatcagcctttcccaagtggccagctaaggacctggcaactcaagtcccaa 832
Query: 1005 atct 1008
||||
Sbjct: 833 atct 836
Score = 44.1 bits (22), Expect = 3e-004
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 242 atggagcagtacgagaaggtggagaagatcggggagggcacgtacggggtggtgtacaag 301
||||| ||||||||||| || |||||||| || || || || ||||| ||||| ||||||
Sbjct: 70 atggaacagtacgagaaagttgagaagataggagaaggtacttacggtgtggtttacaag 129
Query: 302 gc 303
||
Sbjct: 130 gc 131
>gb|M58365.1|ALFPKSTA Medicago sativa CDC2MS serine/threonine protein kinase (CDC2MS)
mRNA, partial cds
Length = 998
Score = 168 bits (85), Expect = 7e-042
Identities = 202/241 (83%)
Strand = Plus / Plus
Query: 585 ttgcgtactgccattctcatagagttcttcaccgagatttgaaacctcagaacttattga 644
|||| ||||| ||||| || ||||||||||| ||||| |||||||| ||||| || ||||
Sbjct: 336 ttgcttactgtcattcacacagagttcttcatcgagacttgaaaccacagaatttgttga 395
Query: 645 tagatcggcgcactaatgcactgaagcttgcagactttggtttagccagggcatttggaa 704
||||||| || |||||| |||| |||||||| || ||||| || |||||||||||||| |
Sbjct: 396 tagatcgccgtactaattcacttaagcttgccgattttggattggccagggcatttggta 455
Query: 705 ttcctgtccgtacatttactcatgaggtagtgacattatggtacagagctccagaaattc 764
|||||||| | |||||||| ||||||||||| ||| | |||||| ||||||| |||||
Sbjct: 456 ttcctgtcagaacatttacacatgaggtagttacactgtggtaccgagctccggaaatat 515
Query: 765 tgcttggagcgaggcagtattccacaccagttgatgtgtggtctgtgggctgtatctttg 824
|||||||| | | || ||||| || ||||||||||| ||||| ||||| ||||| ||||
Sbjct: 516 tgcttggatctcgtcattattctaccccagttgatgtttggtcagtgggatgtatatttg 575
Query: 825 c 825
|
Sbjct: 576 c 576
>gb|AF302013.1| Medicago sativa subsp. x varia CDK-activating kinase (cak) mRNA,
complete cds
Length = 1590
Score = 38.2 bits (19), Expect = 0.016
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 664 actgaagcttgcagactttggtttagc 690
|||||| |||||||| |||||||||||
Sbjct: 568 actgaaacttgcagattttggtttagc 594
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2434
Number of Sequences: 7669
Number of extensions: 2434
Number of successful extensions: 570
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 560
Number of HSP's gapped (non-prelim): 7
length of query: 1354
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1338
effective length of database: 3,623,002
effective search space: 4847576676
effective search space used: 4847576676
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)