BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2418879.2.2
(816 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO514747.1|CO514747 s13dSG55F1100095_328154 Glandular tr... 111 8e-025
gb|AY560003.1| Medicago sativa S-adenosylmethionine synthas... 56 4e-008
gb|CO514605.1|CO514605 s13dSG42G0700056_327870 Glandular tr... 48 1e-005
gb|CO516632.1|CO516632 s13dSG66E0200007_446592 Glandular tr... 48 1e-005
>gb|CO514747.1|CO514747 s13dSG55F1100095_328154 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 435
Score = 111 bits (56), Expect = 8e-025
Identities = 158/192 (82%)
Strand = Plus / Minus
Query: 544 gcggcaggtgtcgcgcacgatcttctcgtagtccacgctcgccttcgtggtgatctcgcc 603
|||||| ||||| || ||||||||||| ||||| ||| | ||||| || || || || ||
Sbjct: 345 gcggcatgtgtcacgaacgatcttctcatagtctacgttggccttggttgttatttctcc 286
Query: 604 gaaaaccatcaccatgttcgtcttggtgcaggtctcgcaggccaccttgctgtcggggtc 663
|| ||||| |||||||| ||||||||||| ||||| ||||| |||||||||| |||||
Sbjct: 285 aaagaccatgaccatgttagtcttggtgcatgtctcacaggcacccttgctgtcagggtc 226
Query: 664 ctgagccaggcaggcgtccagcaccgcgtccgacacctggtcgcacagcttgtctgggtg 723
||| | || || ||||| ||||| || || || | |||||||||||||||||| |||||
Sbjct: 225 ctgctcaagacaagcgtcgagcactgcatcagagatctggtcgcacagcttgtcggggtg 166
Query: 724 cccctcgttcac 735
|||||||||||
Sbjct: 165 accctcgttcac 154
>gb|AY560003.1| Medicago sativa S-adenosylmethionine synthase mRNA, complete cds
Length = 1173
Score = 56.0 bits (28), Expect = 4e-008
Identities = 142/180 (78%)
Strand = Plus / Minus
Query: 584 gccttcgtggtgatctcgccgaaaaccatcaccatgttcgtcttggtgcaggtctcgcag 643
||||| || |||||||| || || ||||| |||||||| ||||| ||||| ||||| ||
Sbjct: 182 gccttggttgtgatctcaccaaagaccataaccatgttggtcttagtgcaagtctcacat 123
Query: 644 gccaccttgctgtcggggtcctgagccaggcaggcgtccagcaccgcgtccgacacctgg 703
|| ||||||||||| |||||| | ||||| || || ||||| || || || | ||
Sbjct: 122 gcaaccttgctgtctacgtcctgttcaaggcaagcatctagcacagcatcagagatttga 63
Query: 704 tcgcacagcttgtctgggtgcccctcgttcacggactccgaggtgaacaggaagctctcc 763
|| || |||||||| || || ||||| ||||||||||| |||||||| || ||| |||||
Sbjct: 62 tcacaaagcttgtcgggatgaccctcattcacggactcagaggtgaatagaaaggtctcc 3
>gb|CO514605.1|CO514605 s13dSG42G0700056_327870 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 600
Score = 48.1 bits (24), Expect = 1e-005
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 700 ctggtcgcacagcttgtctgggtgcccctcgttcac 735
||||||||| |||||||| ||||| |||||||||||
Sbjct: 184 ctggtcgcaaagcttgtcggggtgtccctcgttcac 149
>gb|CO516632.1|CO516632 s13dSG66E0200007_446592 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 425
Score = 48.1 bits (24), Expect = 1e-005
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 700 ctggtcgcacagcttgtctgggtgcccctcgttcac 735
||||||||| |||||||| ||||| |||||||||||
Sbjct: 184 ctggtcgcaaagcttgtcggggtgtccctcgttcac 149
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 872
Number of Sequences: 7669
Number of extensions: 872
Number of successful extensions: 288
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 281
Number of HSP's gapped (non-prelim): 7
length of query: 816
length of database: 3,745,706
effective HSP length: 16
effective length of query: 800
effective length of database: 3,623,002
effective search space: 2898401600
effective search space used: 2898401600
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)