BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2405118.2.1
(1669 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF083332.1|AF083332 Medicago sativa cinnamyl-alcohol deh... 56 8e-008
emb|Z19573.1|MSCIALDHA M.sativa encoding cinnamyl alcohol d... 56 8e-008
gb|L46857.1|ALFCAD1B Medicago sativa cinnamyl-alcohol dehyd... 56 8e-008
>gb|AF083332.1|AF083332 Medicago sativa cinnamyl-alcohol dehydrogenase (MsaCad2) mRNA,
complete cds
Length = 1324
Score = 56.0 bits (28), Expect = 8e-008
Identities = 46/52 (88%)
Strand = Plus / Minus
Query: 1163 tcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||| || || ||||| ||||||||||||||||| ||||| |||||||
Sbjct: 439 tcagtgtaaacatcattgtaagaccagatcttcttgttacagtattgctcaa 388
>emb|Z19573.1|MSCIALDHA M.sativa encoding cinnamyl alcohol dehydrogenase
Length = 1321
Score = 56.0 bits (28), Expect = 8e-008
Identities = 46/52 (88%)
Strand = Plus / Minus
Query: 1163 tcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||| || || ||||| ||||||||||||||||| ||||| |||||||
Sbjct: 463 tcagtgtaaacatcattgtaagaccagatcttcttgttacagtattgctcaa 412
>gb|L46857.1|ALFCAD1B Medicago sativa cinnamyl-alcohol dehydrogenase (cad1) mRNA, partial
cds
Length = 1201
Score = 56.0 bits (28), Expect = 8e-008
Identities = 46/52 (88%)
Strand = Plus / Minus
Query: 1163 tcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||| || || ||||| ||||||||||||||||| ||||| |||||||
Sbjct: 316 tcagtgtaaacatcattgtaagaccagatcttcttgttacagtattgctcaa 265
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2155
Number of Sequences: 7669
Number of extensions: 2155
Number of successful extensions: 545
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 539
Number of HSP's gapped (non-prelim): 6
length of query: 1669
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1653
effective length of database: 3,623,002
effective search space: 5988822306
effective search space used: 5988822306
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)