BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1805363.2.1
(2856 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO516105.1|CO516105 s13dSG65C1200098_445538 Glandular tr... 60 9e-009
gb|DQ122795.1| Medicago sativa clone M22 putative cellulose... 46 1e-004
gb|CO513537.1|CO513537 s13dSG12F0400031_139856 Glandular tr... 34 0.52
gb|CO515832.1|CO515832 s13dSG54E1200097_421203 Glandular tr... 34 0.52
gb|CO514400.1|CO514400 s13dSG36B0400031_327460 Glandular tr... 32 2.1
gb|CO515000.1|CO515000 s13dSG26B0400041_397505 Glandular tr... 32 2.1
gb|AJ410160.1|AJ410160 AJ410160 Medicago sativa library (Ka... 30 8.2
gb|CO512023.1|CO512023 s13dSG07H0900080_103946 Glandular tr... 30 8.2
gb|CO512192.1|CO512192 s13dSG03B0200013_113898 Glandular tr... 30 8.2
gb|CO512362.1|CO512362 s13dSG80A0800053_114238 Glandular tr... 30 8.2
gb|CO512558.1|CO512558 s13dSG08E0700051_121042 Glandular tr... 30 8.2
gb|CO512874.1|CO512874 s13dSG20G0400024_121674 Glandular tr... 30 8.2
gb|CO513347.1|CO513347 s13dSG37H1000080_129858 Glandular tr... 30 8.2
gb|CO513576.1|CO513576 s13dSG16B0400029_139934 Glandular tr... 30 8.2
gb|CO514066.1|CO514066 s13dSG72H0900076_156794 Glandular tr... 30 8.2
gb|CO514238.1|CO514238 s13dSG76B0600045_157138 Glandular tr... 30 8.2
gb|CO514296.1|CO514296 s13dSG76G0700052_157254 Glandular tr... 30 8.2
gb|CO514348.1|CO514348 s13dSG84D1100090_157358 Glandular tr... 30 8.2
gb|CO514516.1|CO514516 s13dSG43F0700061_327692 Glandular tr... 30 8.2
gb|CO514869.1|CO514869 s13dSG56C1100086_328398 Glandular tr... 30 8.2
gb|CO515034.1|CO515034 s13dSG26F0800075_397573 Glandular tr... 30 8.2
gb|CO515174.1|CO515174 s13dSG62C0600050_399213 Glandular tr... 30 8.2
gb|CO515290.1|CO515290 s13dSG48C0200018_417639 Glandular tr... 30 8.2
gb|CO515595.1|CO515595 s13dSG47C0900070_418249 Glandular tr... 30 8.2
gb|CO516056.1|CO516056 s13dSG64E1000083_445440 Glandular tr... 30 8.2
gb|CO516209.1|CO516209 s13dSG67G0300020_445746 Glandular tr... 30 8.2
gb|CO516398.1|CO516398 s13dSG27C0200006_446124 Glandular tr... 30 8.2
gb|CO516473.1|CO516473 s13dSG28C1200098_446274 Glandular tr... 30 8.2
gb|CO516576.1|CO516576 s13dSG57G0800066_446480 Glandular tr... 30 8.2
gb|CO516884.1|CO516884 s13dSG58A1000071_468314 Glandular tr... 30 8.2
gb|CO516936.1|CO516936 s13dSG58G0200008_468418 Glandular tr... 30 8.2
gb|CO517001.1|CO517001 s13dSG81G0900070_468548 Glandular tr... 30 8.2
gb|CO517133.1|CO517133 s13dSG29H0500048_468812 Glandular tr... 30 8.2
gb|CO517157.1|CO517157 s13dSG33C0600050_474398 Glandular tr... 30 8.2
gb|M82973.1|ALFPUTEND Alfalfa putative endomembrane protein... 30 8.2
gb|AF372517.1|AF372517 Medicago sativa 16S ribosomal RNA ge... 30 8.2
gb|AF411550.1| Medicago sativa hypothetical protein mRNA, c... 30 8.2
emb|AJ245868.1|MSA245868 Medicago sativa mRNA for cysteine ... 30 8.2
emb|X68410.1|AMMSK2A A.medicago MSK-2 mRNA for protein kinase 30 8.2
emb|Z11499.1|MSPDIISOM M.sativa mRNA for protein disulfide ... 30 8.2
>gb|CO516105.1|CO516105 s13dSG65C1200098_445538 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 529
Score = 60.0 bits (30), Expect = 9e-009
Identities = 126/158 (79%)
Strand = Plus / Minus
Query: 734 catcatcggttgcctttgatgtgaccgtgaagtttgtgtcgatccctgctagcactttta 793
||||||||| ||| |||||||| || |||||||||||||||| || |||| || || |
Sbjct: 430 catcatcggctgcttttgatgtaacagtgaagtttgtgtcgacaccagctaaaaccttga 371
Query: 794 agagaccttggaacacagcaaagagatgtgcagaggtgccaccaatgacccaaaactgct 853
| ||||||||| | ||||| | ||||| || | || ||||| ||||||||||| |
Sbjct: 370 gcaaaccttggaaaagggcaaaaaaatgtgatgaagcacctccaatcacccaaaactgtt 311
Query: 854 catttctccaccaatcctcaatgccaacaccactccat 891
|||| ||||||||||| || || |||||||||| ||||
Sbjct: 310 cattcctccaccaatcatctattccaacaccaccccat 273
Score = 30.2 bits (15), Expect = 8.2
Identities = 18/19 (94%)
Strand = Plus / Minus
Query: 1141 tcaactgaaccaagagccc 1159
||||| |||||||||||||
Sbjct: 23 tcaacagaaccaagagccc 5
>gb|DQ122795.1| Medicago sativa clone M22 putative cellulose synthase catalytic
subunit mRNA, partial cds
Length = 512
Score = 46.1 bits (23), Expect = 1e-004
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 843 ccaaaactgctcatttctccaccaatc 869
||||||||| |||||||||||||||||
Sbjct: 178 ccaaaactgttcatttctccaccaatc 152
>gb|CO513537.1|CO513537 s13dSG12F0400031_139856 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 549
Score = 34.2 bits (17), Expect = 0.52
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 776 tccctgctagcactttt 792
|||||||||||||||||
Sbjct: 256 tccctgctagcactttt 240
>gb|CO515832.1|CO515832 s13dSG54E1200097_421203 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 563
Score = 34.2 bits (17), Expect = 0.52
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 76 aatcagtacttgaagtt 92
|||||||||||||||||
Sbjct: 455 aatcagtacttgaagtt 471
>gb|CO514400.1|CO514400 s13dSG36B0400031_327460 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 475
Score = 32.2 bits (16), Expect = 2.1
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 1954 attaagaagataagca 1969
||||||||||||||||
Sbjct: 92 attaagaagataagca 107
>gb|CO515000.1|CO515000 s13dSG26B0400041_397505 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 464
Score = 32.2 bits (16), Expect = 2.1
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 1954 attaagaagataagca 1969
||||||||||||||||
Sbjct: 92 attaagaagataagca 107
>gb|AJ410160.1|AJ410160 AJ410160 Medicago sativa library (Kalo P) Medicago sativa cDNA clone
U84, mRNA sequence
Length = 824
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 2018 gccttcttgtggtgc 2032
|||||||||||||||
Sbjct: 367 gccttcttgtggtgc 381
>gb|CO512023.1|CO512023 s13dSG07H0900080_103946 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 616
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 2454 aaacataacatgata 2468
|||||||||||||||
Sbjct: 557 aaacataacatgata 543
>gb|CO512192.1|CO512192 s13dSG03B0200013_113898 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 558
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 920 tagaagcaaaaagca 934
|||||||||||||||
Sbjct: 398 tagaagcaaaaagca 412
>gb|CO512362.1|CO512362 s13dSG80A0800053_114238 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 576
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1940 tgatcacaatccaca 1954
|||||||||||||||
Sbjct: 449 tgatcacaatccaca 435
>gb|CO512558.1|CO512558 s13dSG08E0700051_121042 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 596
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1623 ccttcttttttcttc 1637
|||||||||||||||
Sbjct: 528 ccttcttttttcttc 542
>gb|CO512874.1|CO512874 s13dSG20G0400024_121674 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 458
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1554 tgttgaagatgggag 1568
|||||||||||||||
Sbjct: 287 tgttgaagatgggag 301
>gb|CO513347.1|CO513347 s13dSG37H1000080_129858 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 569
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 2280 ctttcacaaaagaag 2294
|||||||||||||||
Sbjct: 566 ctttcacaaaagaag 552
>gb|CO513576.1|CO513576 s13dSG16B0400029_139934 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 570
Score = 30.2 bits (15), Expect = 8.2
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1840 aaatctttgtggaaactga 1858
|||||||||||| ||||||
Sbjct: 476 aaatctttgtggcaactga 494
>gb|CO514066.1|CO514066 s13dSG72H0900076_156794 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 405
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1617 tcttgtccttctttt 1631
|||||||||||||||
Sbjct: 257 tcttgtccttctttt 243
>gb|CO514238.1|CO514238 s13dSG76B0600045_157138 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 461
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1034 tagatgtaattggat 1048
|||||||||||||||
Sbjct: 56 tagatgtaattggat 42
>gb|CO514296.1|CO514296 s13dSG76G0700052_157254 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 489
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 726 atcaccatcatcatc 740
|||||||||||||||
Sbjct: 110 atcaccatcatcatc 124
>gb|CO514348.1|CO514348 s13dSG84D1100090_157358 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 510
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 829 gtgccaccaatgacc 843
|||||||||||||||
Sbjct: 138 gtgccaccaatgacc 152
>gb|CO514516.1|CO514516 s13dSG43F0700061_327692 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 592
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1617 tcttgtccttctttt 1631
|||||||||||||||
Sbjct: 209 tcttgtccttctttt 195
>gb|CO514869.1|CO514869 s13dSG56C1100086_328398 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 587
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1049 aaacaatggtgttga 1063
|||||||||||||||
Sbjct: 356 aaacaatggtgttga 342
>gb|CO515034.1|CO515034 s13dSG26F0800075_397573 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 468
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 829 gtgccaccaatgacc 843
|||||||||||||||
Sbjct: 138 gtgccaccaatgacc 152
>gb|CO515174.1|CO515174 s13dSG62C0600050_399213 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 495
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 726 atcaccatcatcatc 740
|||||||||||||||
Sbjct: 411 atcaccatcatcatc 425
>gb|CO515290.1|CO515290 s13dSG48C0200018_417639 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 589
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1529 tcaaatccctcttct 1543
|||||||||||||||
Sbjct: 206 tcaaatccctcttct 220
>gb|CO515595.1|CO515595 s13dSG47C0900070_418249 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 584
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1723 gaaacagcatcctgt 1737
|||||||||||||||
Sbjct: 400 gaaacagcatcctgt 386
>gb|CO516056.1|CO516056 s13dSG64E1000083_445440 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 240
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 724 aaatcaccatcatca 738
|||||||||||||||
Sbjct: 51 aaatcaccatcatca 65
>gb|CO516209.1|CO516209 s13dSG67G0300020_445746 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 459
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 726 atcaccatcatcatc 740
|||||||||||||||
Sbjct: 185 atcaccatcatcatc 171
>gb|CO516398.1|CO516398 s13dSG27C0200006_446124 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 386
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 803 ggaacacagcaaaga 817
|||||||||||||||
Sbjct: 221 ggaacacagcaaaga 235
>gb|CO516473.1|CO516473 s13dSG28C1200098_446274 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 560
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1394 tgggtttgttgaagg 1408
|||||||||||||||
Sbjct: 481 tgggtttgttgaagg 467
>gb|CO516576.1|CO516576 s13dSG57G0800066_446480 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 546
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1846 ttgtggaaactgaac 1860
|||||||||||||||
Sbjct: 330 ttgtggaaactgaac 344
>gb|CO516884.1|CO516884 s13dSG58A1000071_468314 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 437
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1617 tcttgtccttctttt 1631
|||||||||||||||
Sbjct: 107 tcttgtccttctttt 93
>gb|CO516936.1|CO516936 s13dSG58G0200008_468418 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 215
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1617 tcttgtccttctttt 1631
|||||||||||||||
Sbjct: 116 tcttgtccttctttt 102
>gb|CO517001.1|CO517001 s13dSG81G0900070_468548 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 453
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1617 tcttgtccttctttt 1631
|||||||||||||||
Sbjct: 316 tcttgtccttctttt 302
>gb|CO517133.1|CO517133 s13dSG29H0500048_468812 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 325
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1617 tcttgtccttctttt 1631
|||||||||||||||
Sbjct: 175 tcttgtccttctttt 161
>gb|CO517157.1|CO517157 s13dSG33C0600050_474398 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 617
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 726 atcaccatcatcatc 740
|||||||||||||||
Sbjct: 236 atcaccatcatcatc 250
>gb|M82973.1|ALFPUTEND Alfalfa putative endomembrane protein mRNA, complete cds
Length = 1770
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 2569 gattggagccaactg 2583
|||||||||||||||
Sbjct: 1254 gattggagccaactg 1240
>gb|AF372517.1|AF372517 Medicago sativa 16S ribosomal RNA gene, partial sequence; and
tRNA-Ile and tRNA-Ala genes, complete sequence;
chloroplast genes for chloroplast products
Length = 2703
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1623 ccttcttttttcttc 1637
|||||||||||||||
Sbjct: 1515 ccttcttttttcttc 1529
>gb|AF411550.1| Medicago sativa hypothetical protein mRNA, complete cds
Length = 1268
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1528 ttcaaatccctcttc 1542
|||||||||||||||
Sbjct: 625 ttcaaatccctcttc 639
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1528 ttcaaatccctcttc 1542
|||||||||||||||
Sbjct: 485 ttcaaatccctcttc 499
>emb|AJ245868.1|MSA245868 Medicago sativa mRNA for cysteine protease, partial (cyp15a gene)
Length = 890
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1940 tgatcacaatccaca 1954
|||||||||||||||
Sbjct: 110 tgatcacaatccaca 96
>emb|X68410.1|AMMSK2A A.medicago MSK-2 mRNA for protein kinase
Length = 1543
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 154 caacatgaaacaggc 168
|||||||||||||||
Sbjct: 1363 caacatgaaacaggc 1349
>emb|Z11499.1|MSPDIISOM M.sativa mRNA for protein disulfide isomerase
Length = 1781
Score = 30.2 bits (15), Expect = 8.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 2569 gattggagccaactg 2583
|||||||||||||||
Sbjct: 1279 gattggagccaactg 1265
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: May 2, 2006 2:40 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6365
Number of Sequences: 7669
Number of extensions: 6365
Number of successful extensions: 1779
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1721
Number of HSP's gapped (non-prelim): 58
length of query: 2856
length of database: 3,745,706
effective HSP length: 17
effective length of query: 2839
effective length of database: 3,615,333
effective search space: 10263930387
effective search space used: 10263930387
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)