BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1804918.2.5
(733 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO512608.1|CO512608 s13dSG13C0400022_121142 Glandular tr... 103 2e-022
gb|CO513390.1|CO513390 s13dSG38E0400023_129944 Glandular tr... 103 2e-022
gb|CO515573.1|CO515573 s13dSG47A0200017_418205 Glandular tr... 103 2e-022
gb|CO514475.1|CO514475 s13dSG43B0600047_327610 Glandular tr... 96 4e-020
>gb|CO512608.1|CO512608 s13dSG13C0400022_121142 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 563
Score = 103 bits (52), Expect = 2e-022
Identities = 181/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 379 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 320
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 319 agcgccgccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 260
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| |||||||| || || ||||||||||| || ||||||
Sbjct: 259 actgtcaccctcagacccttccaatccttggcggtttctttggcgatgtcttctccgatc 200
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 199 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 156
Score = 38.2 bits (19), Expect = 0.008
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 248 tcatcaatctcctgctgca 266
|||||||||||||||||||
Sbjct: 550 tcatcaatctcctgctgca 532
>gb|CO513390.1|CO513390 s13dSG38E0400023_129944 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 440
Score = 103 bits (52), Expect = 2e-022
Identities = 181/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 372 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 313
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 312 agcgccgccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 253
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| |||||||| || || ||||||||||| || ||||||
Sbjct: 252 actgtcaccctcagacccttccaatccttggcggtttctttggcgatgtcttctccgatc 193
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 192 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 149
>gb|CO515573.1|CO515573 s13dSG47A0200017_418205 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 572
Score = 103 bits (52), Expect = 2e-022
Identities = 181/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 382 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 323
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 322 agcgccgccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 263
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| |||||||| || || ||||||||||| || ||||||
Sbjct: 262 actgtcaccctcagacccttccaatccttggcggtttctttggcgatgtcttctccgatc 203
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 202 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 159
Score = 38.2 bits (19), Expect = 0.008
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 248 tcatcaatctcctgctgca 266
|||||||||||||||||||
Sbjct: 553 tcatcaatctcctgctgca 535
>gb|CO514475.1|CO514475 s13dSG43B0600047_327610 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 518
Score = 95.6 bits (48), Expect = 4e-020
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||| ||||| |||||||| || ||||| || ||||| | |||||| || ||
Sbjct: 367 tgcttgatattcttcgtcttcttcctatctctctctggttccttcaacgccttaatcacc 308
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || |||||||| || || | ||||| || || || ||||||||||||||||||
Sbjct: 307 agcgccgccgcggagggaacaaccgcaaccttcgcttgacgattctggacggtgagcttg 248
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| ||||| || || ||||||||||| || || || || ||||||||||| || ||||||
Sbjct: 247 actgtgacacggagacccttccagtcttttgcggtttctttggcgatgtcttctccgatc 188
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || || |||||||| || |||||
Sbjct: 187 ttctttggagagagaccgaggggaccaatcttgggagcgaggga 144
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1616
Number of Sequences: 7669
Number of extensions: 1616
Number of successful extensions: 364
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 355
Number of HSP's gapped (non-prelim): 6
length of query: 733
length of database: 3,745,706
effective HSP length: 16
effective length of query: 717
effective length of database: 3,623,002
effective search space: 2597692434
effective search space used: 2597692434
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)