BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1804918.2.4
(634 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO514475.1|CO514475 s13dSG43B0600047_327610 Glandular tr... 133 2e-031
gb|CO512608.1|CO512608 s13dSG13C0400022_121142 Glandular tr... 117 1e-026
gb|CO513390.1|CO513390 s13dSG38E0400023_129944 Glandular tr... 117 1e-026
gb|CO515573.1|CO515573 s13dSG47A0200017_418205 Glandular tr... 117 1e-026
gb|CO513639.1|CO513639 s13dSG17A0400021_140060 Glandular tr... 40 0.002
gb|AJ966562.1|AJ966562 AJ966562 Medicago sativa subsp. falc... 32 0.45
>gb|CO514475.1|CO514475 s13dSG43B0600047_327610 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 518
Score = 133 bits (67), Expect = 2e-031
Identities = 178/215 (82%)
Strand = Plus / Minus
Query: 378 tgcttgatgttcttgaccttcttcctgtccctctcgggttccttgagcgccttgatgacg 437
|||||||| ||||| ||||||||| || ||||| |||||||| | |||||| || ||
Sbjct: 367 tgcttgatattcttcgtcttcttcctatctctctctggttccttcaacgccttaatcacc 308
Query: 438 agcgccgcggcggaggggacgacggagaccttggcctgccggttctgcacggtgagcttg 497
|||||||| |||||||| || || | ||||| || || || ||||| ||||||||||||
Sbjct: 307 agcgccgccgcggagggaacaaccgcaaccttcgcttgacgattctggacggtgagcttg 248
Query: 498 acggtgacgcggaggcccttccagtccttggcggtctccttggcgatgtcctcgccgatc 557
|| ||||| ||||| ||||||||||| || ||||| || ||||||||||| || ||||||
Sbjct: 247 actgtgacacggagacccttccagtcttttgcggtttctttggcgatgtcttctccgatc 188
Query: 558 ttcttcggggagagaccgagcgggccgatcttggg 592
||||| || ||||||||||| || || ||||||||
Sbjct: 187 ttctttggagagagaccgaggggaccaatcttggg 153
>gb|CO512608.1|CO512608 s13dSG13C0400022_121142 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 563
Score = 117 bits (59), Expect = 1e-026
Identities = 176/215 (81%)
Strand = Plus / Minus
Query: 378 tgcttgatgttcttgaccttcttcctgtccctctcgggttccttgagcgccttgatgacg 437
|||||||||||||| |||||| | ||||| || |||||||| | |||||||| ||
Sbjct: 379 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 320
Query: 438 agcgccgcggcggaggggacgacggagaccttggcctgccggttctgcacggtgagcttg 497
|||||||| || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 319 agcgccgccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 260
Query: 498 acggtgacgcggaggcccttccagtccttggcggtctccttggcgatgtcctcgccgatc 557
|| || || | || |||||||| ||||||||||| || ||||||||||| || ||||||
Sbjct: 259 actgtcaccctcagacccttccaatccttggcggtttctttggcgatgtcttctccgatc 200
Query: 558 ttcttcggggagagaccgagcgggccgatcttggg 592
||||| || ||||||||||| || |||||||||||
Sbjct: 199 ttctttggtgagagaccgagaggaccgatcttggg 165
Score = 54.0 bits (27), Expect = 1e-007
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 201 tcaccatcatcgatctcctgctgcaagtccttggggtccttcccatc 247
||||||||||| |||||||||||||| ||||| || || ||||||||
Sbjct: 556 tcaccatcatcaatctcctgctgcaaatcctttggatctttcccatc 510
>gb|CO513390.1|CO513390 s13dSG38E0400023_129944 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 440
Score = 117 bits (59), Expect = 1e-026
Identities = 176/215 (81%)
Strand = Plus / Minus
Query: 378 tgcttgatgttcttgaccttcttcctgtccctctcgggttccttgagcgccttgatgacg 437
|||||||||||||| |||||| | ||||| || |||||||| | |||||||| ||
Sbjct: 372 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 313
Query: 438 agcgccgcggcggaggggacgacggagaccttggcctgccggttctgcacggtgagcttg 497
|||||||| || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 312 agcgccgccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 253
Query: 498 acggtgacgcggaggcccttccagtccttggcggtctccttggcgatgtcctcgccgatc 557
|| || || | || |||||||| ||||||||||| || ||||||||||| || ||||||
Sbjct: 252 actgtcaccctcagacccttccaatccttggcggtttctttggcgatgtcttctccgatc 193
Query: 558 ttcttcggggagagaccgagcgggccgatcttggg 592
||||| || ||||||||||| || |||||||||||
Sbjct: 192 ttctttggtgagagaccgagaggaccgatcttggg 158
>gb|CO515573.1|CO515573 s13dSG47A0200017_418205 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 572
Score = 117 bits (59), Expect = 1e-026
Identities = 176/215 (81%)
Strand = Plus / Minus
Query: 378 tgcttgatgttcttgaccttcttcctgtccctctcgggttccttgagcgccttgatgacg 437
|||||||||||||| |||||| | ||||| || |||||||| | |||||||| ||
Sbjct: 382 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 323
Query: 438 agcgccgcggcggaggggacgacggagaccttggcctgccggttctgcacggtgagcttg 497
|||||||| || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 322 agcgccgccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 263
Query: 498 acggtgacgcggaggcccttccagtccttggcggtctccttggcgatgtcctcgccgatc 557
|| || || | || |||||||| ||||||||||| || ||||||||||| || ||||||
Sbjct: 262 actgtcaccctcagacccttccaatccttggcggtttctttggcgatgtcttctccgatc 203
Query: 558 ttcttcggggagagaccgagcgggccgatcttggg 592
||||| || ||||||||||| || |||||||||||
Sbjct: 202 ttctttggtgagagaccgagaggaccgatcttggg 168
Score = 56.0 bits (28), Expect = 3e-008
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 192 atctcgacctcaccatcatcgatctcctgctgcaagtccttggggtccttcccatc 247
||||| || ||||||||||| |||||||||||||| ||||| || || ||||||||
Sbjct: 568 atctcaacatcaccatcatcaatctcctgctgcaaatcctttggatctttcccatc 513
>gb|CO513639.1|CO513639 s13dSG17A0400021_140060 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 316
Score = 40.1 bits (20), Expect = 0.002
Identities = 47/56 (83%)
Strand = Plus / Minus
Query: 192 atctcgacctcaccatcatcgatctcctgctgcaagtccttggggtccttcccatc 247
||||| || ||||||||| |||||||||||||| ||||| || || ||||||||
Sbjct: 159 atctcaacatcaccatcactaatctcctgctgcaaatcctttggatctttcccatc 104
>gb|AJ966562.1|AJ966562 AJ966562 Medicago sativa subsp. falcata flower buds Medicago sativa
subsp. falcata cDNA clone Em13, mRNA sequence
Length = 280
Score = 32.2 bits (16), Expect = 0.45
Identities = 46/56 (82%)
Strand = Plus / Plus
Query: 192 atctcgacctcaccatcatcgatctcctgctgcaagtccttggggtccttcccatc 247
||||| || ||||||||||| |||| || ||||| | |||||| || ||||||||
Sbjct: 88 atctcaacatcaccatcatcaatctgttgttgcaaatgcttgggatctttcccatc 143
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 744
Number of Sequences: 7669
Number of extensions: 744
Number of successful extensions: 196
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 184
Number of HSP's gapped (non-prelim): 12
length of query: 634
length of database: 3,745,706
effective HSP length: 16
effective length of query: 618
effective length of database: 3,623,002
effective search space: 2239015236
effective search space used: 2239015236
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)