BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1804918.2.3
(985 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO512608.1|CO512608 s13dSG13C0400022_121142 Glandular tr... 125 6e-029
gb|CO513390.1|CO513390 s13dSG38E0400023_129944 Glandular tr... 125 6e-029
gb|CO515573.1|CO515573 s13dSG47A0200017_418205 Glandular tr... 125 6e-029
gb|CO514475.1|CO514475 s13dSG43B0600047_327610 Glandular tr... 121 1e-027
gb|CO515656.1|CO515656 s13dSG60C0500038_419461 Glandular tr... 36 0.045
>gb|CO512608.1|CO512608 s13dSG13C0400022_121142 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 563
Score = 125 bits (63), Expect = 6e-029
Identities = 177/215 (82%)
Strand = Plus / Minus
Query: 623 tgcttgatgttcttgaccttcttgcggtccctctctggctccttgagcgccttgatgacg 682
|||||||||||||| ||||||||| ||||| ||||| ||||| | |||||||| ||
Sbjct: 379 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 320
Query: 683 agcgccgcggcggaggggacgacggagaccttggcctgccggttctggacggtgagcttg 742
|||||||| || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 319 agcgccgccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 260
Query: 743 acggtgacgcggaggcccttccagtccttggccgtctccttggcgatgtcctctccgatc 802
|| || || | || |||||||| |||||||| || || ||||||||||| |||||||||
Sbjct: 259 actgtcaccctcagacccttccaatccttggcggtttctttggcgatgtcttctccgatc 200
Query: 803 ttcttgggggaaagaccgagcgggccgatcttggg 837
||||| || || |||||||| || |||||||||||
Sbjct: 199 ttctttggtgagagaccgagaggaccgatcttggg 165
>gb|CO513390.1|CO513390 s13dSG38E0400023_129944 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 440
Score = 125 bits (63), Expect = 6e-029
Identities = 177/215 (82%)
Strand = Plus / Minus
Query: 623 tgcttgatgttcttgaccttcttgcggtccctctctggctccttgagcgccttgatgacg 682
|||||||||||||| ||||||||| ||||| ||||| ||||| | |||||||| ||
Sbjct: 372 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 313
Query: 683 agcgccgcggcggaggggacgacggagaccttggcctgccggttctggacggtgagcttg 742
|||||||| || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 312 agcgccgccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 253
Query: 743 acggtgacgcggaggcccttccagtccttggccgtctccttggcgatgtcctctccgatc 802
|| || || | || |||||||| |||||||| || || ||||||||||| |||||||||
Sbjct: 252 actgtcaccctcagacccttccaatccttggcggtttctttggcgatgtcttctccgatc 193
Query: 803 ttcttgggggaaagaccgagcgggccgatcttggg 837
||||| || || |||||||| || |||||||||||
Sbjct: 192 ttctttggtgagagaccgagaggaccgatcttggg 158
>gb|CO515573.1|CO515573 s13dSG47A0200017_418205 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 572
Score = 125 bits (63), Expect = 6e-029
Identities = 177/215 (82%)
Strand = Plus / Minus
Query: 623 tgcttgatgttcttgaccttcttgcggtccctctctggctccttgagcgccttgatgacg 682
|||||||||||||| ||||||||| ||||| ||||| ||||| | |||||||| ||
Sbjct: 382 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 323
Query: 683 agcgccgcggcggaggggacgacggagaccttggcctgccggttctggacggtgagcttg 742
|||||||| || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 322 agcgccgccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 263
Query: 743 acggtgacgcggaggcccttccagtccttggccgtctccttggcgatgtcctctccgatc 802
|| || || | || |||||||| |||||||| || || ||||||||||| |||||||||
Sbjct: 262 actgtcaccctcagacccttccaatccttggcggtttctttggcgatgtcttctccgatc 203
Query: 803 ttcttgggggaaagaccgagcgggccgatcttggg 837
||||| || || |||||||| || |||||||||||
Sbjct: 202 ttctttggtgagagaccgagaggaccgatcttggg 168
>gb|CO514475.1|CO514475 s13dSG43B0600047_327610 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 518
Score = 121 bits (61), Expect = 1e-027
Identities = 154/185 (83%)
Strand = Plus / Minus
Query: 653 ctctctggctccttgagcgccttgatgacgagcgccgcggcggaggggacgacggagacc 712
|||||||| ||||| | |||||| || || |||||||| |||||||| || || | |||
Sbjct: 337 ctctctggttccttcaacgccttaatcaccagcgccgccgcggagggaacaaccgcaacc 278
Query: 713 ttggcctgccggttctggacggtgagcttgacggtgacgcggaggcccttccagtccttg 772
|| || || || |||||||||||||||||||| ||||| ||||| ||||||||||| ||
Sbjct: 277 ttcgcttgacgattctggacggtgagcttgactgtgacacggagacccttccagtctttt 218
Query: 773 gccgtctccttggcgatgtcctctccgatcttcttgggggaaagaccgagcgggccgatc 832
|| || || ||||||||||| |||||||||||||| || || |||||||| || || |||
Sbjct: 217 gcggtttctttggcgatgtcttctccgatcttctttggagagagaccgaggggaccaatc 158
Query: 833 ttggg 837
|||||
Sbjct: 157 ttggg 153
>gb|CO515656.1|CO515656 s13dSG60C0500038_419461 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 447
Score = 36.2 bits (18), Expect = 0.045
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 930 cgggcgtgggagtggcggcggc 951
||||||||| ||||||||||||
Sbjct: 259 cgggcgtggtagtggcggcggc 238
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1860
Number of Sequences: 7669
Number of extensions: 1860
Number of successful extensions: 739
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 728
Number of HSP's gapped (non-prelim): 11
length of query: 985
length of database: 3,745,706
effective HSP length: 16
effective length of query: 969
effective length of database: 3,623,002
effective search space: 3510688938
effective search space used: 3510688938
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)