BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131584.2.4
(739 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AJ410120.1|AJ410120 AJ410120 Medicago sativa library (Ka... 88 1e-017
>gb|AJ410120.1|AJ410120 AJ410120 Medicago sativa library (Kalo P) Medicago sativa cDNA
clone U40, mRNA sequence
Length = 757
Score = 87.7 bits (44), Expect = 1e-017
Identities = 182/228 (79%)
Strand = Plus / Plus
Query: 202 aagaaagaggaggaggaatttagcacaggccctctgtcagtcctaatgatgagtgttaag 261
||||| ||||| |||||||| | ||| || || || || || || ||||||||||| ||
Sbjct: 144 aagaatgaggaagaggaattcaacactggtccactatctgtactcatgatgagtgtgaaa 203
Query: 262 aacaacacccaggtcctcatcaattgccgcaacaacaagaagctgcttggccgtgttcgt 321
|||||||| ||||| || |||||||| || |||||||| ||||| || |||||||| |
Sbjct: 204 aacaacacacaggttctgatcaattgtcgtaacaacaaaaagcttctaggccgtgtcagg 263
Query: 322 gcttttgatcgccactgtaacatggtgctcgagaacgtgcgtgagatgtggacagagatc 381
||||||||| | ||||| || ||||| || || || || || || |||||||| ||| |
Sbjct: 264 gcttttgatagacactgcaatatggttcttgaaaatgtccgggaaatgtggactgaggtg 323
Query: 382 cccaagactggcaagggcaaaaagaaggctctgcctgtgaacaaggat 429
|| |||||||| || || || |||||||||| ||| || |||||||||
Sbjct: 324 cctaagactggtaaaggaaagaagaaggctcagccagtcaacaaggat 371
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1503
Number of Sequences: 7669
Number of extensions: 1503
Number of successful extensions: 425
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 424
Number of HSP's gapped (non-prelim): 1
length of query: 739
length of database: 3,745,706
effective HSP length: 16
effective length of query: 723
effective length of database: 3,623,002
effective search space: 2619430446
effective search space used: 2619430446
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)