BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 131584.2.4
         (739 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AJ410120.1|AJ410120  AJ410120 Medicago sativa library (Ka...    88   1e-017
>gb|AJ410120.1|AJ410120 AJ410120 Medicago sativa library (Kalo P) Medicago sativa cDNA
           clone U40, mRNA sequence
          Length = 757

 Score = 87.7 bits (44), Expect = 1e-017
 Identities = 182/228 (79%)
 Strand = Plus / Plus

                                                                       
Query: 202 aagaaagaggaggaggaatttagcacaggccctctgtcagtcctaatgatgagtgttaag 261
           ||||| ||||| |||||||| | ||| || || || || || || ||||||||||| || 
Sbjct: 144 aagaatgaggaagaggaattcaacactggtccactatctgtactcatgatgagtgtgaaa 203

                                                                       
Query: 262 aacaacacccaggtcctcatcaattgccgcaacaacaagaagctgcttggccgtgttcgt 321
           |||||||| ||||| || |||||||| || |||||||| ||||| || ||||||||  | 
Sbjct: 204 aacaacacacaggttctgatcaattgtcgtaacaacaaaaagcttctaggccgtgtcagg 263

                                                                       
Query: 322 gcttttgatcgccactgtaacatggtgctcgagaacgtgcgtgagatgtggacagagatc 381
           ||||||||| | ||||| || ||||| || || || || || || |||||||| ||| | 
Sbjct: 264 gcttttgatagacactgcaatatggttcttgaaaatgtccgggaaatgtggactgaggtg 323

                                                           
Query: 382 cccaagactggcaagggcaaaaagaaggctctgcctgtgaacaaggat 429
           || |||||||| || || || |||||||||| ||| || |||||||||
Sbjct: 324 cctaagactggtaaaggaaagaagaaggctcagccagtcaacaaggat 371
  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1503
Number of Sequences: 7669
Number of extensions: 1503
Number of successful extensions: 425
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 424
Number of HSP's gapped (non-prelim): 1
length of query: 739
length of database: 3,745,706
effective HSP length: 16
effective length of query: 723
effective length of database: 3,623,002
effective search space: 2619430446
effective search space used: 2619430446
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)