BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131543.2.5
(545 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO511931.1|CO511931 s13dSG05G0200020_103762 Glandular tr... 66 3e-011
gb|CO514409.1|CO514409 s13dSG36C0400024_327478 Glandular tr... 66 3e-011
gb|CO515008.1|CO515008 s13dSG26C0400034_397521 Glandular tr... 66 3e-011
gb|CO513374.1|CO513374 s13dSG38C0900066_129912 Glandular tr... 32 0.39
gb|CO516661.1|CO516661 s13dSG66H0300028_446650 Glandular tr... 32 0.39
gb|DQ122847.1| Medicago sativa clone NF6 putative imbibitio... 32 0.39
>gb|CO511931.1|CO511931 s13dSG05G0200020_103762 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 464
Score = 65.9 bits (33), Expect = 3e-011
Identities = 117/145 (80%)
Strand = Plus / Minus
Query: 282 cttccttgagtacctcaagttcctcagaaacttcgggtccatccccttggtggaggtctg 341
|||||||| |||||| |||||||| |||||| || |||||||| ||||| || || ||
Sbjct: 189 cttccttgcatacctctggttcctcaaaaactttggatccatccctttggttgaagtgtg 130
Query: 342 gcggtggcgcttgggcttcttgatgccgttcttgtgcgccttgaacgattggttatgcgc 401
|| || | ||| |||||||||||||| |||||||| || ||| | || ||||| || ||
Sbjct: 129 acgatgcctctttggcttcttgatgccattcttgtgagctttgtaagactggttgtgagc 70
Query: 402 cgtgtggttcttcgacttggccatc 426
||||| |||||||| || ||||||
Sbjct: 69 ggtgtgattcttcgatttcgccatc 45
>gb|CO514409.1|CO514409 s13dSG36C0400024_327478 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 367
Score = 65.9 bits (33), Expect = 3e-011
Identities = 117/145 (80%)
Strand = Plus / Minus
Query: 282 cttccttgagtacctcaagttcctcagaaacttcgggtccatccccttggtggaggtctg 341
|||||||| |||||| |||||||| |||||| || |||||||| ||||| || || ||
Sbjct: 189 cttccttgcatacctctggttcctcaaaaactttggatccatccctttggttgaagtgtg 130
Query: 342 gcggtggcgcttgggcttcttgatgccgttcttgtgcgccttgaacgattggttatgcgc 401
|| || | ||| |||||||||||||| |||||||| || ||| | || ||||| || ||
Sbjct: 129 acgatgcctctttggcttcttgatgccattcttgtgagctttgtaagactggttgtgagc 70
Query: 402 cgtgtggttcttcgacttggccatc 426
||||| |||||||| || ||||||
Sbjct: 69 ggtgtgattcttcgatttcgccatc 45
>gb|CO515008.1|CO515008 s13dSG26C0400034_397521 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 367
Score = 65.9 bits (33), Expect = 3e-011
Identities = 117/145 (80%)
Strand = Plus / Minus
Query: 282 cttccttgagtacctcaagttcctcagaaacttcgggtccatccccttggtggaggtctg 341
|||||||| |||||| |||||||| |||||| || |||||||| ||||| || || ||
Sbjct: 189 cttccttgcatacctctggttcctcaaaaactttggatccatccctttggttgaagtgtg 130
Query: 342 gcggtggcgcttgggcttcttgatgccgttcttgtgcgccttgaacgattggttatgcgc 401
|| || | ||| |||||||||||||| |||||||| || ||| | || ||||| || ||
Sbjct: 129 acgatgcctctttggcttcttgatgccattcttgtgagctttgtaagactggttgtgagc 70
Query: 402 cgtgtggttcttcgacttggccatc 426
||||| |||||||| || ||||||
Sbjct: 69 ggtgtgattcttcgatttcgccatc 45
>gb|CO513374.1|CO513374 s13dSG38C0900066_129912 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 170
Score = 32.2 bits (16), Expect = 0.39
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 46 atacaagtgatggttt 61
||||||||||||||||
Sbjct: 22 atacaagtgatggttt 7
>gb|CO516661.1|CO516661 s13dSG66H0300028_446650 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 478
Score = 32.2 bits (16), Expect = 0.39
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 130 tcatacacaagtcctttgat 149
|||| |||||||||||||||
Sbjct: 231 tcatccacaagtcctttgat 212
>gb|DQ122847.1| Medicago sativa clone NF6 putative imbibition protein
homolog/alkaline alpha galactosidase mRNA, partial cds
Length = 627
Score = 32.2 bits (16), Expect = 0.39
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 356 gcttcttgatgccgtt 371
||||||||||||||||
Sbjct: 287 gcttcttgatgccgtt 272
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1316
Number of Sequences: 7669
Number of extensions: 1316
Number of successful extensions: 437
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 431
Number of HSP's gapped (non-prelim): 6
length of query: 545
length of database: 3,745,706
effective HSP length: 16
effective length of query: 529
effective length of database: 3,623,002
effective search space: 1916568058
effective search space used: 1916568058
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)