BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.451
(1101 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO514693.1|CO514693 s13dSG46H1100096_328046 Glandular tr... 206 2e-053
gb|CO514795.1|CO514795 s13dSG59C0900070_328250 Glandular tr... 157 2e-038
gb|CO512828.1|CO512828 s13dSG20B1200093_121582 Glandular tr... 34 0.20
>gb|CO514693.1|CO514693 s13dSG46H1100096_328046 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 552
Score = 206 bits (104), Expect = 2e-053
Identities = 374/464 (80%)
Strand = Plus / Plus
Query: 95 atgaagttcaacatcgcgaacccttccaccgggtgccaaaagaagctggaaatcgatgac 154
|||||||||||| | || || || |||| || ||||| |||||||| ||||||||||||
Sbjct: 66 atgaagttcaacgttgcaaatccaaccactggttgccagaagaagcttgaaatcgatgac 125
Query: 155 gaccagaagctgcgtgccttttatgaccgaaggatatcccaggaggtcagtggtgatgct 214
||| |||||| ||||| |||| ||| ||||| || || ||||| |||||||||
Sbjct: 126 gacatgaagcttcgtgcattttgggacaagaggatctcacaagaggttttgggtgatgct 185
Query: 215 ctgggtgaggagttcaagggttatgtcttcaagatcatgggtggatgtgacaagcaaggc 274
| || || || || ||||| ||||||||||| |||| |||||||||||||| |||||
Sbjct: 186 ttaggcgaagaatttaagggatatgtcttcaaaatcactggtggatgtgacaaacaagga 245
Query: 275 ttcccaatgaagcaaggagttttgacttctggtcgtgttcgtcttctgctccataggggc 334
|| ||||||||||| || || || || ||||||||||||| || ||||||| || ||
Sbjct: 246 tttccaatgaagcagggtgtgttaacccctggtcgtgttcgcctcttgctccacagaggt 305
Query: 335 actccctgcttccgtggttatggcaggcgtaatggtgagcgcaggaggaagtctgtccgt 394
||||| || ||||| || | || ||||||||||| ||| | || ||||||||||| |||
Sbjct: 306 actccttgtttccgaggacacggaaggcgtaatggagagagaagaaggaagtctgttcgt 365
Query: 395 ggttgcatcgtgagccaagacctatctgttatcaacttggtgattgtgaagaagggtgag 454
|| ||||| || |||| |||||| |||||| | |||||||| |||||||||||||||||
Sbjct: 366 gggtgcattgtcagcccagacctctctgttctgaacttggttattgtgaagaagggtgaa 425
Query: 455 aatgatctgcctggtctgactgacactgagaagccaaggatgaggggtcccaagagggcc 514
|||||| |||| ||| ||||||| ||| |||||||| ||||||||||| ||||| ||
Sbjct: 426 aatgatttgccaggtttgactgatgttgaaaagccaagaatgaggggtcctaagagagct 485
Query: 515 tccaagatcagaaagctgttcaaccttaacaaggatgatgatgt 558
||||| ||| | ||||| ||||| ||| |||||||||||||||
Sbjct: 486 tccaaaatccgtaagctcttcaatctttccaaggatgatgatgt 529
>gb|CO514795.1|CO514795 s13dSG59C0900070_328250 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 449
Score = 157 bits (79), Expect = 2e-038
Identities = 213/258 (82%)
Strand = Plus / Plus
Query: 205 tggtgatgctctgggtgaggagttcaagggttatgtcttcaagatcatgggtggatgtga 264
|||||||||| |||| || ||||| |||||||||||||||||||||| ||||| |||||
Sbjct: 178 tggtgatgctttgggagaagagtttaagggttatgtcttcaagatcactggtgggtgtga 237
Query: 265 caagcaaggcttcccaatgaagcaaggagttttgacttctggtcgtgttcgtcttctgct 324
||| ||||| |||||||||||||| ||||| ||||| |||| |||||| | || ||||
Sbjct: 238 caaacaaggattcccaatgaagcagggagtgttgacccctggccgtgttaggctcttgct 297
Query: 325 ccataggggcactccctgcttccgtggttatggcaggcgtaatggtgagcgcaggaggaa 384
|||||| || ||||| || |||||||| | || ||||| ||||| ||||| | |||||
Sbjct: 298 ccatagaggaactccttgtttccgtggacacggaaggcgcaatggagagcgtanaaggaa 357
Query: 385 gtctgtccgtggttgcatcgtgagccaagacctatctgttatcaacttggtgattgtgaa 444
|||||| ||||| ||||| || |||| ||||| |||||| | |||||||| |||| ||
Sbjct: 358 gtctgttcgtggatgcattgtcagccccgacctctctgttttgaacttggttattggtaa 417
Query: 445 gaagggtgagaatgatct 462
||| ||||| ||||||||
Sbjct: 418 gaaaggtgataatgatct 435
>gb|CO512828.1|CO512828 s13dSG20B1200093_121582 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 544
Score = 34.2 bits (17), Expect = 0.20
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 689 aagaagaagaggataac 705
|||||||||||||||||
Sbjct: 142 aagaagaagaggataac 126
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2152
Number of Sequences: 7669
Number of extensions: 2152
Number of successful extensions: 576
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 570
Number of HSP's gapped (non-prelim): 6
length of query: 1101
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1085
effective length of database: 3,623,002
effective search space: 3930957170
effective search space used: 3930957170
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)