BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCS16e03.yg.2.1
(608 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA007616.1|CA007616 HU08I04r HU Hordeum vulgare subsp. v... 182 9e-045
gb|CA018111.1|CA018111 HV07H21r HV Hordeum vulgare subsp. v... 117 4e-025
gb|AV836714.1|AV836714 AV836714 K. Sato unpublished cDNA li... 64 6e-009
gb|BE215258.1|BE215258 HV_CEb0006E21f Hordeum vulgare seedl... 64 6e-009
gb|BM928833.1|BM928833 LP10006 Lemma/palea-enriched cDNA li... 42 0.021
gb|BM928834.1|BM928834 LP10007 Lemma/palea-enriched cDNA li... 42 0.021
gb|BM928843.1|BM928843 LP10030 Lemma/palea-enriched cDNA li... 42 0.021
gb|BQ134683.1|BQ134683 LP30159 Lemma/palea-enriched cDNA li... 42 0.021
gb|BM376088.2|BM376088 EBma01_SQ002_F01_R maternal, 4 DPA, ... 42 0.021
gb|BM371429.2|BM371429 EBma08_SQ002_L04_R maternal, 28 DPA,... 42 0.021
gb|BM376133.1|BM376133 EBma01_SQ002_H07_R maternal, 4 DPA, ... 40 0.082
gb|BM928858.1|BM928858 LP20059 Lemma/palea-enriched cDNA li... 40 0.082
gb|BQ134670.1|BQ134670 LP30108 Lemma/palea-enriched cDNA li... 40 0.082
gb|BM376094.2|BM376094 EBma01_SQ002_F09_R maternal, 4 DPA, ... 40 0.082
gb|BM371381.2|BM371381 EBma08_SQ002_I05_R maternal, 28 DPA,... 40 0.082
gb|BM371382.2|BM371382 EBma08_SQ002_I06_R maternal, 28 DPA,... 40 0.082
gb|CD240764.1|CD240764 LP30021 Lemma/palea-enriched cDNA li... 40 0.082
gb|BM928867.1|BM928867 LP300020 Lemma/palea-enriched cDNA l... 38 0.33
>gb|CA007616.1|CA007616 HU08I04r HU Hordeum vulgare subsp. vulgare cDNA clone HU08I04
5-PRIME, mRNA sequence
Length = 622
Score = 182 bits (92), Expect = 9e-045
Identities = 200/236 (84%)
Strand = Plus / Minus
Query: 114 gccctcgtaagaaccgcagtgaaggtgaaagtagaaccaacttggggtttacttgcaaat 173
||||||| ||| || |||||||||| ||| ||||||||||| ||| |||| ||| ||||
Sbjct: 308 gccctcgaaagtactgcagtgaaggagaacgtagaaccaacatggtgtttgcttacaaac 249
Query: 174 ccaatctctcccctcatgagtccaaccaagcatttgctgatgcttaatccaatgccagtg 233
|||||||| ||| ||||||| ||||| ||| ||||||||||| ||||| |||||||||
Sbjct: 248 ccaatctcccccttcatgagatgaaccaggcacttgctgatgctcaatccgatgccagtg 189
Query: 234 cccccatggatgcgagcaatggatggacctacttgcatgaaaggggtgaagacacgggac 293
|||||||||||||| |||||||| ||||| || ||||||||||| ||||| | |||||
Sbjct: 188 cccccatggatgcgggcaatggacggaccaacctgcatgaaaggcgtgaatatgcgggat 129
Query: 294 tgagcatcgaacgggattccaacacccgtatcttcaactgatattatcaagcttat 349
|| || || | |||||| || ||||| ||||||||||||||||||||||| |||||
Sbjct: 128 tgggcttcaagcgggatgccgacaccagtatcttcaactgatattatcaatcttat 73
Score = 63.9 bits (32), Expect = 6e-009
Identities = 50/56 (89%)
Strand = Plus / Minus
Query: 24 gtaaccttggcacggaccggcctatgatctaccaccaatgcattgatccctttaaa 79
||||| |||||||| |||||||||||||| || ||||||||| ||| |||||||||
Sbjct: 398 gtaacattggcacgaaccggcctatgatcaactaccaatgcactgacccctttaaa 343
>gb|CA018111.1|CA018111 HV07H21r HV Hordeum vulgare subsp. vulgare cDNA clone HV07H21
5-PRIME, mRNA sequence
Length = 241
Score = 117 bits (59), Expect = 4e-025
Identities = 141/170 (82%)
Strand = Plus / Minus
Query: 114 gccctcgtaagaaccgcagtgaaggtgaaagtagaaccaacttggggtttacttgcaaat 173
||||||| ||| || |||||||||| ||| | ||||||| ||| |||| ||| ||||
Sbjct: 204 gccctcgaaagtactgcagtgaaggagaacgnnnaaccaacatggtgtttgcttacaaac 145
Query: 174 ccaatctctcccctcatgagtccaaccaagcatttgctgatgcttaatccaatgccagtg 233
|||||||| ||| ||||||| ||||| ||| ||||||||||| ||||| ||| ||||
Sbjct: 144 ccaatctcccccttcatgagatgaaccaggcacttgctgatgctcaatccgatgnnagtg 85
Query: 234 cccccatggatgcgagcaatggatggacctacttgcatgaaaggggtgaa 283
|||||||||||||| |||||||| ||||| || ||||||||||| |||||
Sbjct: 84 cccccatggatgcgggcaatggacggaccaacctgcatgaaaggcgtgaa 35
>gb|AV836714.1|AV836714 AV836714 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
vulgare seedling leaves second leaf stage Hordeum
vulgare subsp. vulgare cDNA clone basd26p01, mRNA
sequence
Length = 635
Score = 63.9 bits (32), Expect = 6e-009
Identities = 77/92 (83%)
Strand = Plus / Minus
Query: 258 ggacctacttgcatgaaaggggtgaagacacgggactgagcatcgaacgggattccaaca 317
||||| || ||||||||||| ||||| | ||||| || || || | |||||| || |||
Sbjct: 631 ggaccaacctgcatgaaaggcgtgaatatgcgggattgggcttcaagcgggatgccgaca 572
Query: 318 cccgtatcttcaactgatattatcaagcttat 349
|| ||||||||||||||||||||||| |||||
Sbjct: 571 ccagtatcttcaactgatattatcaatcttat 540
>gb|BE215258.1|BE215258 HV_CEb0006E21f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0006E21f, mRNA sequence
Length = 677
Score = 63.9 bits (32), Expect = 6e-009
Identities = 50/56 (89%)
Strand = Plus / Minus
Query: 24 gtaaccttggcacggaccggcctatgatctaccaccaatgcattgatccctttaaa 79
||||| |||||||| |||||||||||||| || ||||||||| ||| |||||||||
Sbjct: 119 gtaacattggcacgaaccggcctatgatcaactaccaatgcactgacccctttaaa 64
>gb|BM928833.1|BM928833 LP10006 Lemma/palea-enriched cDNA library from elongation stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 1-6,
mRNA sequence
Length = 544
Score = 42.1 bits (21), Expect = 0.021
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacc 21
|||||||||||||||||||||
Sbjct: 254 gcggccgcccgggcaggtacc 274
Score = 40.1 bits (20), Expect = 0.082
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 261 gcggccgcccgggcaggtac 242
>gb|BM928834.1|BM928834 LP10007 Lemma/palea-enriched cDNA library from elongation stage
of kernel Hordeum vulgare subsp. vulgare cDNA clone
1-7, mRNA sequence
Length = 420
Score = 42.1 bits (21), Expect = 0.021
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacc 21
|||||||||||||||||||||
Sbjct: 10 gcggccgcccgggcaggtacc 30
>gb|BM928843.1|BM928843 LP10030 Lemma/palea-enriched cDNA library from elongation stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 1-30
similar to Cytosolic GA3PDH gene, mRNA sequence
Length = 478
Score = 42.1 bits (21), Expect = 0.021
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacc 21
|||||||||||||||||||||
Sbjct: 283 gcggccgcccgggcaggtacc 303
Score = 40.1 bits (20), Expect = 0.082
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 290 gcggccgcccgggcaggtac 271
>gb|BQ134683.1|BQ134683 LP30159 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-159
similar to putative ABC transporter, mRNA sequence
Length = 339
Score = 42.1 bits (21), Expect = 0.021
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtacc 21
|||||||||||||||||||||
Sbjct: 281 gcggccgcccgggcaggtacc 261
>gb|BM376088.2|BM376088 EBma01_SQ002_F01_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_F01 5', mRNA sequence
Length = 256
Score = 42.1 bits (21), Expect = 0.021
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacc 21
|||||||||||||||||||||
Sbjct: 84 gcggccgcccgggcaggtacc 104
>gb|BM371429.2|BM371429 EBma08_SQ002_L04_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_L04 5', mRNA sequence
Length = 454
Score = 42.1 bits (21), Expect = 0.021
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacc 21
|||||||||||||||||||||
Sbjct: 84 gcggccgcccgggcaggtacc 104
>gb|BM376133.1|BM376133 EBma01_SQ002_H07_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_H07 5', mRNA sequence
Length = 422
Score = 40.1 bits (20), Expect = 0.082
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 360 gcggccgcccgggcaggtac 341
>gb|BM928858.1|BM928858 LP20059 Lemma/palea-enriched cDNA library from gelatinous stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 2-59
similar to Rubisco small sub-unit gene, mRNA sequence
Length = 491
Score = 40.1 bits (20), Expect = 0.082
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 260 gcggccgcccgggcaggtac 241
>gb|BQ134670.1|BQ134670 LP30108 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-108,
mRNA sequence
Length = 530
Score = 40.1 bits (20), Expect = 0.082
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 347 gcggccgcccgggcaggtac 328
>gb|BM376094.2|BM376094 EBma01_SQ002_F09_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_F09 5', mRNA sequence
Length = 387
Score = 40.1 bits (20), Expect = 0.082
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 353 gcggccgcccgggcaggtac 334
>gb|BM371381.2|BM371381 EBma08_SQ002_I05_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_I05 5', mRNA sequence
Length = 581
Score = 40.1 bits (20), Expect = 0.082
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 519 gcggccgcccgggcaggtac 500
>gb|BM371382.2|BM371382 EBma08_SQ002_I06_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_I06 5', mRNA sequence
Length = 494
Score = 40.1 bits (20), Expect = 0.082
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 433 gcggccgcccgggcaggtac 414
>gb|CD240764.1|CD240764 LP30021 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-21
similar to A. thaliana AtRer1A, Accession No. AY044321,
mRNA sequence
Length = 342
Score = 40.1 bits (20), Expect = 0.082
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 323 gcggccgcccgggcaggtac 342
Score = 38.2 bits (19), Expect = 0.33
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggta 19
|||||||||||||||||||
Sbjct: 330 gcggccgcccgggcaggta 312
>gb|BM928867.1|BM928867 LP300020 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-20,
mRNA sequence
Length = 216
Score = 38.2 bits (19), Expect = 0.33
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 2 cggccgcccgggcaggtac 20
|||||||||||||||||||
Sbjct: 212 cggccgcccgggcaggtac 194
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 38,403
Number of Sequences: 312970
Number of extensions: 38403
Number of successful extensions: 8458
Number of sequences better than 0.5: 18
Number of HSP's better than 0.5 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8433
Number of HSP's gapped (non-prelim): 25
length of query: 608
length of database: 175,134,539
effective HSP length: 19
effective length of query: 589
effective length of database: 169,188,109
effective search space: 99651796201
effective search space used: 99651796201
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)