BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCH22b04.yg.2.1
(457 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA021581.1|CA021581 HZ40I04r HZ Hordeum vulgare subsp. v... 170 3e-041
gb|AV833557.1|AV833557 AV833557 K. Sato unpublished cDNA li... 82 2e-014
gb|BU987426.1|BU987426 HF14L16r HF Hordeum vulgare subsp. v... 82 2e-014
gb|CK125346.1|CK125346 BES1824107m01 BES1824 Hordeum vulgar... 82 2e-014
gb|BU973765.1|BU973765 HB25O11r BC Hordeum vulgare subsp. v... 58 3e-007
gb|AA231934.1|AA231934 BCD926.F cDNA from barley Hordeum vu... 56 1e-006
gb|CA030098.1|CA030098 HX06B10r HX Hordeum vulgare subsp. v... 48 3e-004
gb|BJ472879.1|BJ472879 BJ472879 K. Sato unpublished cDNA li... 40 0.061
gb|BU983633.1|BU983633 HA30G17r HA Hordeum vulgare subsp. v... 40 0.061
>gb|CA021581.1|CA021581 HZ40I04r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ40I04
5-PRIME, mRNA sequence
Length = 637
Score = 170 bits (86), Expect = 3e-041
Identities = 145/165 (87%)
Strand = Plus / Plus
Query: 6 gagttactttgccatgaaggttatggataagacttctttggcaagtcggaagaagctgct 65
|||| ||||||| |||||||| |||||||| || ||| |||| ||||| |||||||||||
Sbjct: 469 gagtcactttgcaatgaaggtgatggataaaacatctctggctagtcgcaagaagctgct 528
Query: 66 tcgagctcagaccgagcgggagatcctgcagtccctggaccatccatttctaccaaccct 125
|| || ||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 529 ccgggcgcagaccgagcgggagatactgcagtccctggatcatccatttctgccaaccct 588
Query: 126 gtatactcactttgagacagacaagttttcatgcttggttatgga 170
|||||||| | |||||| |||||||||||||| ||||||||||
Sbjct: 589 atatactcattntgagacggacaagttttcatgtctggttatgga 633
>gb|AV833557.1|AV833557 AV833557 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
vulgare shoots germination Hordeum vulgare subsp.
vulgare cDNA clone bags15d19, mRNA sequence
Length = 552
Score = 81.8 bits (41), Expect = 2e-014
Identities = 104/125 (83%)
Strand = Plus / Plus
Query: 250 tatgtagctgaggtgctccttgcattggaatacctgcatatgcttgggattatataccgt 309
||||| ||||| || |||||||||||||| || ||||||||| | ||| ||||||| |||
Sbjct: 422 tatgtcgctgaagttctccttgcattggagtatctgcatatgttgggggttatatatcgt 481
Query: 310 gatcttaaaccagagaatgtcctcgttcgggaagatggccacatcatgctgtcggacttc 369
||||| || || ||||| | || ||||| |||||||| ||||||||||| || |||||
Sbjct: 482 gatctgaagcctgagaacatacttgttcgtgaagatgggcacatcatgctctccgacttt 541
Query: 370 gatct 374
|||||
Sbjct: 542 gatct 546
>gb|BU987426.1|BU987426 HF14L16r HF Hordeum vulgare subsp. vulgare cDNA clone HF14L16
5-PRIME, mRNA sequence
Length = 539
Score = 81.8 bits (41), Expect = 2e-014
Identities = 104/125 (83%)
Strand = Plus / Plus
Query: 250 tatgtagctgaggtgctccttgcattggaatacctgcatatgcttgggattatataccgt 309
||||| ||||| || |||||||||||||| || ||||||||| | ||| ||||||| |||
Sbjct: 409 tatgtcgctgaagttctccttgcattggagtatctgcatatgttgggggttatatatcgt 468
Query: 310 gatcttaaaccagagaatgtcctcgttcgggaagatggccacatcatgctgtcggacttc 369
||||| || || ||||| | || ||||| |||||||| ||||||||||| || |||||
Sbjct: 469 gatctgaagcctgagaacatacttgttcgtgaagatgggcacatcatgctctccgacttt 528
Query: 370 gatct 374
|||||
Sbjct: 529 gatct 533
>gb|CK125346.1|CK125346 BES1824107m01 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010M017 5-PRIME, mRNA sequence
Length = 884
Score = 81.8 bits (41), Expect = 2e-014
Identities = 104/125 (83%)
Strand = Plus / Plus
Query: 250 tatgtagctgaggtgctccttgcattggaatacctgcatatgcttgggattatataccgt 309
||||| ||||| || |||||||||||||| || ||||||||| | ||| ||||||| |||
Sbjct: 562 tatgtcgctgaagttctccttgcattggagtatctgcatatgttgggggttatatatcgt 621
Query: 310 gatcttaaaccagagaatgtcctcgttcgggaagatggccacatcatgctgtcggacttc 369
||||| || || ||||| | || ||||| |||||||| ||||||||||| || |||||
Sbjct: 622 gatctgaagcctgagaacatacttgttcgtgaagatgggcacatcatgctctccgacttt 681
Query: 370 gatct 374
|||||
Sbjct: 682 gatct 686
>gb|BU973765.1|BU973765 HB25O11r BC Hordeum vulgare subsp. vulgare cDNA clone HB25O11
5-PRIME, mRNA sequence
Length = 500
Score = 58.0 bits (29), Expect = 3e-007
Identities = 83/101 (82%)
Strand = Plus / Plus
Query: 85 gagatcctgcagtccctggaccatccatttctaccaaccctgtatactcactttgagaca 144
||||| ||||||| | | |||||||| ||||| || || |||| || |||||||||||
Sbjct: 374 gagatactgcagtgcttagaccatccttttcttccgactttgtacacgcactttgagact 433
Query: 145 gacaagttttcatgcttggttatggaattctgccctggagg 185
|| || || ||||||||||| ||||| || |||||||||||
Sbjct: 434 gataaattctcatgcttggtgatggagttttgccctggagg 474
>gb|AA231934.1|AA231934 BCD926.F cDNA from barley Hordeum vulgare subsp. vulgare cDNA clone
BCD926, mRNA sequence
Length = 312
Score = 56.0 bits (28), Expect = 1e-006
Identities = 67/80 (83%)
Strand = Plus / Plus
Query: 376 tctcttcgctgttcagtgagcctaacggtgatcaagtccgcaaatcctggcctagatgca 435
|||||||| |||||||| |||| ||| ||||||| | |||||||||||| |||| ||
Sbjct: 15 tctcttcgttgttcagttagcccaaccgtgatcaggggtgcaaatcctggcttagacgcg 74
Query: 436 atgcagaggaacaatgcagc 455
|||||||||| ||||||||
Sbjct: 75 ctgcagaggaataatgcagc 94
>gb|CA030098.1|CA030098 HX06B10r HX Hordeum vulgare subsp. vulgare cDNA clone HX06B10
5-PRIME, mRNA sequence
Length = 639
Score = 48.1 bits (24), Expect = 3e-004
Identities = 102/128 (79%)
Strand = Plus / Plus
Query: 55 aagaagctgcttcgagctcagaccgagcgggagatcctgcagtccctggaccatccattt 114
|||||| |||||||||| ||||| ||| ||| ||| | |||| | |||| ||||| ||
Sbjct: 170 aagaagttgcttcgagcccagactgagaaggaaatcttacagtgcttggatcatcctttc 229
Query: 115 ctaccaaccctgtatactcactttgagacagacaagttttcatgcttggttatggaattc 174
|| || || |||| || ||||||||||| |||||||| || || |||||||||| ||
Sbjct: 230 cttccgacattgtacacacactttgagactgacaagttctcgtgtctggttatggagttt 289
Query: 175 tgccctgg 182
||||||||
Sbjct: 290 tgccctgg 297
>gb|BJ472879.1|BJ472879 BJ472879 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal39h24 5', mRNA sequence
Length = 452
Score = 40.1 bits (20), Expect = 0.061
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 292 cttgggattatataccgtgatcttaaaccaga 323
||||| ||||||||||||||| | ||||||||
Sbjct: 336 cttggcattatataccgtgatttgaaaccaga 367
>gb|BU983633.1|BU983633 HA30G17r HA Hordeum vulgare subsp. vulgare cDNA clone HA30G17
5-PRIME, mRNA sequence
Length = 493
Score = 40.1 bits (20), Expect = 0.061
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 316 aaaccagagaatgtcctcgttcgggaagatggccacatcatgctgtcggacttcga 371
|||||||| ||||| || || || || ||||||||||| ||||| || ||||||||
Sbjct: 286 aaaccagaaaatgttctggtgcgtgatgatggccacataatgctttcagacttcga 341
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 35,723
Number of Sequences: 312970
Number of extensions: 35723
Number of successful extensions: 9274
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9258
Number of HSP's gapped (non-prelim): 16
length of query: 457
length of database: 175,134,539
effective HSP length: 18
effective length of query: 439
effective length of database: 169,501,079
effective search space: 74410973681
effective search space used: 74410973681
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)