BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QBTB.006E19F020311.3.1
         (789 letters)

Database: Hordeum_nucl_with_EST.fasta 
           312,970 sequences; 175,134,539 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AU252299.1|AU252299  AU252299 salt-stressed barley root c...    70   1e-010

>gb|AU252299.1|AU252299 AU252299 salt-stressed barley root cDNA Hordeum vulgare subsp.
           vulgare cDNA clone BR-M09 similar to putative ABC
           transporter, mRNA sequence
          Length = 423

 Score = 69.9 bits (35), Expect = 1e-010
 Identities = 113/139 (81%)
 Strand = Plus / Plus

                                                                       
Query: 422 ctgtcttctcttctgagtgtcttattcttcacatggatcatcgaacttcttttcccagtt 481
           ||||||||||||||  |||   |||||||||  |||||| | | ||| || || ||||||
Sbjct: 278 ctgtcttctcttcttggtgcactattcttcagctggatcgttgtactactgtttccagtt 337

                                                                       
Query: 482 atgttgacatatctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcac 541
           ||  | |||||||| |||||||||||||| || ||||| |  ||||||||||| ||||| 
Sbjct: 338 atactaacatatctcgtgtatgagaagcaacaaaagctgaaaattatgatgaagatgcat 397

                              
Query: 542 ggtctgaaggatgggcctt 560
           ||| |||||||||| ||||
Sbjct: 398 ggtttgaaggatggccctt 416



  Database: Hordeum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:16 PM
  Number of letters in database: 175,134,539
  Number of sequences in database:  312,970
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 65,033
Number of Sequences: 312970
Number of extensions: 65033
Number of successful extensions: 15429
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15425
Number of HSP's gapped (non-prelim): 3
length of query: 789
length of database: 175,134,539
effective HSP length: 19
effective length of query: 770
effective length of database: 169,188,109
effective search space: 130274843930
effective search space used: 130274843930
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)