BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBN10e11.xg.2.2
(581 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL507698.1|AL507698 AL507698 Hordeum vulgare Barke devel... 46 0.001
gb|BG300712.2|BG300712 HVSMEb0018B21f Hordeum vulgare seedl... 46 0.001
gb|BE215659.3|BE215659 HV_CEb0007L14f Hordeum vulgare seedl... 46 0.001
gb|AV917169.1|AV917169 AV917169 K. Sato unpublished cDNA li... 46 0.001
gb|AV926015.1|AV926015 AV926015 K. Sato unpublished cDNA li... 46 0.001
gb|AV932284.1|AV932284 AV932284 K. Sato unpublished cDNA li... 46 0.001
gb|AV932668.1|AV932668 AV932668 K. Sato unpublished cDNA li... 46 0.001
gb|AV932909.1|AV932909 AV932909 K. Sato unpublished cDNA li... 46 0.001
gb|BJ472039.1|BJ472039 BJ472039 K. Sato unpublished cDNA li... 46 0.001
gb|BQ468511.1|BQ468511 HM01H13T HM Hordeum vulgare subsp. v... 46 0.001
gb|BQ756038.1|BQ756038 EBem05_SQ001_G05_R embryo, 14 DPA, n... 46 0.001
gb|BU984788.1|BU984788 HF05A10r HF Hordeum vulgare subsp. v... 46 0.001
gb|CA012169.1|CA012169 HT04K11r HT Hordeum vulgare subsp. v... 46 0.001
gb|CA023543.1|CA023543 HZ46J08r HZ Hordeum vulgare subsp. v... 46 0.001
gb|CA028274.1|CA028274 HZ61I02r HZ Hordeum vulgare subsp. v... 46 0.001
gb|CK122610.1|CK122610 BES1824104j23 BES1824 Hordeum vulgar... 46 0.001
gb|BF629444.2|BF629444 HVSMEb0012H02f Hordeum vulgare seedl... 40 0.078
>gb|AL507698.1|AL507698 AL507698 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY06J16V 5',
mRNA sequence
Length = 700
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 261 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 319
>gb|BG300712.2|BG300712 HVSMEb0018B21f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0018B21f, mRNA sequence
Length = 601
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 263 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 321
>gb|BE215659.3|BE215659 HV_CEb0007L14f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0007L14f, mRNA sequence
Length = 523
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 251 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 309
>gb|AV917169.1|AV917169 AV917169 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags8c03 5', mRNA sequence
Length = 503
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 59 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 117
>gb|AV926015.1|AV926015 AV926015 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basdm08 5', mRNA sequence
Length = 623
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 562 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 620
>gb|AV932284.1|AV932284 AV932284 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal2p18 5', mRNA sequence
Length = 469
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 171 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 229
>gb|AV932668.1|AV932668 AV932668 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal1j14 5', mRNA sequence
Length = 580
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 102 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 160
>gb|AV932909.1|AV932909 AV932909 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal4j24 5', mRNA sequence
Length = 677
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 181 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 239
>gb|BJ472039.1|BJ472039 BJ472039 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal31k11 5', mRNA sequence
Length = 628
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 155 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 213
>gb|BQ468511.1|BQ468511 HM01H13T HM Hordeum vulgare subsp. vulgare cDNA clone HM01H13
5-PRIME, mRNA sequence
Length = 525
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 345 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 403
>gb|BQ756038.1|BQ756038 EBem05_SQ001_G05_R embryo, 14 DPA, no treatment, cv Optic, EBem05
Hordeum vulgare subsp. vulgare cDNA clone
EBem05_SQ001_G05 5', mRNA sequence
Length = 406
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 267 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 325
>gb|BU984788.1|BU984788 HF05A10r HF Hordeum vulgare subsp. vulgare cDNA clone HF05A10
5-PRIME, mRNA sequence
Length = 567
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 271 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 329
>gb|CA012169.1|CA012169 HT04K11r HT Hordeum vulgare subsp. vulgare cDNA clone HT04K11
5-PRIME, mRNA sequence
Length = 507
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 211 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 269
>gb|CA023543.1|CA023543 HZ46J08r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ46J08
5-PRIME, mRNA sequence
Length = 376
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 272 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 330
>gb|CA028274.1|CA028274 HZ61I02r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ61I02
5-PRIME, mRNA sequence
Length = 678
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 281 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 339
>gb|CK122610.1|CK122610 BES1824104j23 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010J234 5-PRIME, mRNA sequence
Length = 730
Score = 46.1 bits (23), Expect = 0.001
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 1 actatgatcttgtcactggcttctacgaatatggatggggcgactcattccattttgct 59
|||||||||||| ||| |||||||||| ||||| ||||| || || ||||| ||||||
Sbjct: 278 actatgatcttgctactagcttctacgagtatggctggggtgaatccttccactttgct 336
>gb|BF629444.2|BF629444 HVSMEb0012H02f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0012H02f, mRNA sequence
Length = 819
Score = 40.1 bits (20), Expect = 0.078
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 132 atctcagtagagatgccgagttgt 155
|||||||||| |||||||||||||
Sbjct: 170 atctcagtagggatgccgagttgt 147
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 33,676
Number of Sequences: 312970
Number of extensions: 33676
Number of successful extensions: 8151
Number of sequences better than 0.5: 17
Number of HSP's better than 0.5 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8134
Number of HSP's gapped (non-prelim): 17
length of query: 581
length of database: 175,134,539
effective HSP length: 19
effective length of query: 562
effective length of database: 169,188,109
effective search space: 95083717258
effective search space used: 95083717258
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)