BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBJ24c04.pg.2.1
(448 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BQ661443.1|BQ661443 HM03I08u HM Hordeum vulgare subsp. v... 54 4e-006
gb|CB880524.1|CB880524 HM06N05w HM Hordeum vulgare subsp. v... 54 4e-006
gb|CB881625.1|CB881625 HM10G06w HM Hordeum vulgare subsp. v... 54 4e-006
gb|CB881506.1|CB881506 HM10A08w HM Hordeum vulgare subsp. v... 46 0.001
>gb|BQ661443.1|BQ661443 HM03I08u HM Hordeum vulgare subsp. vulgare cDNA clone HM03I08
3-PRIME, mRNA sequence
Length = 520
Score = 54.0 bits (27), Expect = 4e-006
Identities = 54/64 (84%)
Strand = Plus / Plus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| | ||||||| || |||||||||||||||||||||
Sbjct: 239 tccagttggcggggatgacgtcctgggcgatgagcttcttgccggactcgctggtgaggc 298
Query: 354 ggat 357
||||
Sbjct: 299 ggat 302
>gb|CB880524.1|CB880524 HM06N05w HM Hordeum vulgare subsp. vulgare cDNA clone HM06N05
3-PRIME, mRNA sequence
Length = 545
Score = 54.0 bits (27), Expect = 4e-006
Identities = 54/64 (84%)
Strand = Plus / Plus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| | ||||||| || |||||||||||||||||||||
Sbjct: 250 tccagttggcggggatgacgtcctgggcgatgagcttcttgccggactcgctggtgaggc 309
Query: 354 ggat 357
||||
Sbjct: 310 ggat 313
>gb|CB881625.1|CB881625 HM10G06w HM Hordeum vulgare subsp. vulgare cDNA clone HM10G06
3-PRIME, mRNA sequence
Length = 588
Score = 54.0 bits (27), Expect = 4e-006
Identities = 54/64 (84%)
Strand = Plus / Plus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| | ||||||| || |||||||||||||||||||||
Sbjct: 240 tccagttggcggggatgacgtcctgggcgatgagcttcttgccggactcgctggtgaggc 299
Query: 354 ggat 357
||||
Sbjct: 300 ggat 303
>gb|CB881506.1|CB881506 HM10A08w HM Hordeum vulgare subsp. vulgare cDNA clone HM10A08
3-PRIME, mRNA sequence
Length = 368
Score = 46.1 bits (23), Expect = 0.001
Identities = 53/64 (82%)
Strand = Plus / Plus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| | ||||||| || |||||||||| ||||||||||
Sbjct: 287 tccagttggcggggatgacgtcctgggcgatgagcttcttgccggactccctggtgaggc 346
Query: 354 ggat 357
||||
Sbjct: 347 ggat 350
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 25,321
Number of Sequences: 312970
Number of extensions: 25321
Number of successful extensions: 7325
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 7321
Number of HSP's gapped (non-prelim): 4
length of query: 448
length of database: 175,134,539
effective HSP length: 18
effective length of query: 430
effective length of database: 169,501,079
effective search space: 72885463970
effective search space used: 72885463970
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)