BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAN24c09.yg.2.1
(425 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BG414971.1|BG414971 HVSMEk0004I03f Hordeum vulgare testa... 92 2e-017
gb|AV914152.1|AV914152 AV914152 K. Sato unpublished cDNA li... 92 2e-017
gb|AV914933.1|AV914933 AV914933 K. Sato unpublished cDNA li... 92 2e-017
gb|AV925215.1|AV925215 AV925215 K. Sato unpublished cDNA li... 92 2e-017
gb|AV932043.1|AV932043 AV932043 K. Sato unpublished cDNA li... 92 2e-017
gb|BM816138.1|BM816138 HC109B12_T3.ab1 HC Hordeum vulgare s... 92 2e-017
gb|BM816139.1|BM816139 HC105G09_T3.ab1 HC Hordeum vulgare s... 92 2e-017
gb|BQ463573.1|BQ463573 HI05L24r HI Hordeum vulgare subsp. v... 92 2e-017
gb|BQ465804.1|BQ465804 HU04L18r HU Hordeum vulgare subsp. v... 92 2e-017
gb|BQ469182.1|BQ469182 HM03K08r HM Hordeum vulgare subsp. v... 92 2e-017
gb|BI779022.2|BI779022 EBro01_SQ002_J19_R root, 3 week, hyd... 92 2e-017
gb|BU971759.1|BU971759 HB19J12r BC Hordeum vulgare subsp. v... 92 2e-017
gb|CA012990.1|CA012990 HT07B01r HT Hordeum vulgare subsp. v... 92 2e-017
gb|BU990492.1|BU990492 HF25D10r HF Hordeum vulgare subsp. v... 88 3e-016
gb|AV927219.1|AV927219 AV927219 K. Sato unpublished cDNA li... 84 4e-015
gb|BJ464018.1|BJ464018 BJ464018 K. Sato unpublished cDNA li... 84 4e-015
gb|CA025840.1|CA025840 HZ53E19r HZ Hordeum vulgare subsp. v... 82 2e-014
gb|BQ739972.1|BQ739972 HB107G12 HB Hordeum vulgare subsp. v... 70 6e-011
gb|AV925770.1|AV925770 AV925770 K. Sato unpublished cDNA li... 68 3e-010
gb|AV926207.1|AV926207 AV926207 K. Sato unpublished cDNA li... 68 3e-010
gb|AV926208.1|AV926208 AV926208 K. Sato unpublished cDNA li... 68 3e-010
gb|BQ468619.1|BQ468619 HM01M13T HM Hordeum vulgare subsp. v... 68 3e-010
gb|BI776485.2|BI776485 EBpi05_SQ001_J01_R pistil, 8 DPA, no... 68 3e-010
gb|BU984513.1|BU984513 HF04C11r HF Hordeum vulgare subsp. v... 68 3e-010
gb|BU986849.1|BU986849 HF13B10r HF Hordeum vulgare subsp. v... 68 3e-010
gb|BU988138.1|BU988138 HF16M09r HF Hordeum vulgare subsp. v... 68 3e-010
gb|CA025257.1|CA025257 HZ51J24r HZ Hordeum vulgare subsp. v... 68 3e-010
gb|CB876338.1|CB876338 HX10P19w HX Hordeum vulgare subsp. v... 68 3e-010
gb|AV913277.1|AV913277 AV913277 K. Sato unpublished cDNA li... 64 4e-009
gb|AV913278.1|AV913278 AV913278 K. Sato unpublished cDNA li... 64 4e-009
gb|BQ465284.1|BQ465284 HU03C22r HU Hordeum vulgare subsp. v... 64 4e-009
gb|AV931092.1|AV931092 AV931092 K. Sato unpublished cDNA li... 60 6e-008
gb|BG417165.1|BG417165 HVSMEk0016J06f Hordeum vulgare testa... 58 2e-007
gb|AV931093.1|AV931093 AV931093 K. Sato unpublished cDNA li... 56 1e-006
gb|BU967242.1|BU967242 HB03K11r BC Hordeum vulgare subsp. v... 56 1e-006
gb|CB860194.1|CB860194 HI12P13w HI Hordeum vulgare subsp. v... 56 1e-006
gb|AL503512.1|AL503512 AL503512 Hordeum vulgare Barke roots... 52 1e-005
gb|BF258638.2|BF258638 HVSMEf0016E13f Hordeum vulgare seedl... 52 1e-005
gb|BF064711.2|BF064711 HV_CEb0017G02f Hordeum vulgare seedl... 52 1e-005
gb|BJ453328.1|BJ453328 BJ453328 K. Sato unpublished cDNA li... 52 1e-005
gb|BQ467842.1|BQ467842 HR01B16r HR Hordeum vulgare subsp. v... 52 1e-005
gb|BM376392.2|BM376392 EBem05_SQ002_B14_R embryo, 14 DPA, n... 52 1e-005
gb|BU972673.1|BU972673 HB22G06r BC Hordeum vulgare subsp. v... 52 1e-005
gb|BU985115.1|BU985115 HF06C19r HF Hordeum vulgare subsp. v... 52 1e-005
gb|CA030609.1|CA030609 HX07J05r HX Hordeum vulgare subsp. v... 52 1e-005
gb|CA030647.1|CA030647 HX07L05r HX Hordeum vulgare subsp. v... 52 1e-005
gb|BG365821.2|BG365821 HVSMEi0004F18f Hordeum vulgare 20 DA... 50 6e-005
gb|BM817226.1|BM817226 HC109A10_T3.ab1 HC Hordeum vulgare s... 50 6e-005
gb|BG343963.1|BG343963 HVSMEg0007D23f Hordeum vulgare pre-a... 48 2e-004
gb|BG369245.1|BG369245 HVSMEi0023G07f Hordeum vulgare 20 DA... 46 0.001
gb|BI779535.2|BI779535 EBro01_SQ004_F12_R root, 3 week, hyd... 46 0.001
gb|BQ765797.1|BQ765797 EBro03_SQ008_O01_R root, 3 week, wat... 46 0.001
gb|BI949437.1|BI949437 HVSMEl0013O09f Hordeum vulgare spike... 42 0.014
gb|BI955734.1|BI955734 HVSMEm0024E12f Hordeum vulgare green... 42 0.014
gb|AV917031.1|AV917031 AV917031 K. Sato unpublished cDNA li... 42 0.014
gb|BF259974.3|BF259974 HVSMEf0020M07f Hordeum vulgare seedl... 40 0.057
gb|AV923333.1|AV923333 AV923333 K. Sato unpublished cDNA li... 40 0.057
gb|AV928513.1|AV928513 AV928513 K. Sato unpublished cDNA li... 40 0.057
gb|AV931601.1|AV931601 AV931601 K. Sato unpublished cDNA li... 38 0.22
gb|AJ462437.1|AJ462437 AJ462437 S00002 Hordeum vulgare subs... 38 0.22
gb|CB876220.1|CB876220 HX10K07w HX Hordeum vulgare subsp. v... 38 0.22
>gb|BG414971.1|BG414971 HVSMEk0004I03f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0004I03f, mRNA sequence
Length = 634
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 246 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 305
Query: 283 ggaggt 288
||||||
Sbjct: 306 ggaggt 311
>gb|AV914152.1|AV914152 AV914152 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags4p09 5', mRNA sequence
Length = 583
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 166 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 225
Query: 283 ggaggt 288
||||||
Sbjct: 226 ggaggt 231
>gb|AV914933.1|AV914933 AV914933 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags9b06 5', mRNA sequence
Length = 654
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 167 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 226
Query: 283 ggaggt 288
||||||
Sbjct: 227 ggaggt 232
>gb|AV925215.1|AV925215 AV925215 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd22e04 5', mRNA sequence
Length = 656
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 174 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 233
Query: 283 ggaggt 288
||||||
Sbjct: 234 ggaggt 239
>gb|AV932043.1|AV932043 AV932043 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal2a04 5', mRNA sequence
Length = 615
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 506 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 565
Query: 283 ggaggt 288
||||||
Sbjct: 566 ggaggt 571
>gb|BM816138.1|BM816138 HC109B12_T3.ab1 HC Hordeum vulgare subsp. vulgare cDNA clone
HC109B12_T3.ab1 similar to (AF200528) cellulose
synthase-4 [Zea mays],(AF200529) cellulose synthase-5
[Zea mays],(AF200533) cellulose synthase-9 [Zea
mays],cellulose synthase catalytic subunit [Arabidopsis
thaliana],unnamed protein product [Arabidopsis
thaliana],, mRNA sequence
Length = 880
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 365 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 424
Query: 283 ggaggt 288
||||||
Sbjct: 425 ggaggt 430
>gb|BM816139.1|BM816139 HC105G09_T3.ab1 HC Hordeum vulgare subsp. vulgare cDNA clone
HC105G09_T3.ab1 similar to (AF200528) cellulose
synthase-4 [Zea mays],(AF200529) cellulose synthase-5
[Zea mays],(AF200533) cellulose synthase-9 [Zea
mays],cellulose synthase catalytic subunit [Arabidopsis
thaliana],unnamed protein product [Arabidopsis
thaliana],, mRNA sequence
Length = 916
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 127 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 186
Query: 283 ggaggt 288
||||||
Sbjct: 187 ggaggt 192
>gb|BQ463573.1|BQ463573 HI05L24r HI Hordeum vulgare subsp. vulgare cDNA clone HI05L24
5-PRIME, mRNA sequence
Length = 591
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 400 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 459
Query: 283 ggaggt 288
||||||
Sbjct: 460 ggaggt 465
>gb|BQ465804.1|BQ465804 HU04L18r HU Hordeum vulgare subsp. vulgare cDNA clone HU04L18
5-PRIME, mRNA sequence
Length = 644
Score = 91.7 bits (46), Expect = 2e-017
Identities = 182/230 (79%)
Strand = Plus / Plus
Query: 175 tggttcatgtcactttttatctgcatttttgctacaagcatcctnnnaatgagatggagt 234
|||| |||||||||||| ||||||||||| ||||| | || || |||||||||| |
Sbjct: 244 tggtacatgtcacttttcatctgcattttcgctacgggtattctggaaatgagatgggct 303
Query: 235 ggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcc 294
|||| | |||| ||||||||||| || |||||||||||||||||||||||||| ||
Sbjct: 304 cgtgtcgcagttgacgattggtggagaaacgagcagttctgggtcattggaggtgtctct 363
Query: 295 tcgcacctcttcgctgtgtttcagggacttctcnnggtcatagctggtgttgatacaagc 354
| || || || || ||||| || ||||||||| ||| ||||||||||| || || |||
Sbjct: 364 gcccatctatttgccgtgttccaaggacttctcaaggtgatagctggtgtggacactagc 423
Query: 355 tncactnngacatcaaagggtggagatgatgacgaattctcagagctgta 404
| ||| ||| |||||| ||||||||||| || || || ||||||||
Sbjct: 424 ttcaccgtcacaacaaaggccggagatgatgaggagttttctgagctgta 473
>gb|BQ469182.1|BQ469182 HM03K08r HM Hordeum vulgare subsp. vulgare cDNA clone HM03K08
5-PRIME, mRNA sequence
Length = 660
Score = 91.7 bits (46), Expect = 2e-017
Identities = 182/230 (79%)
Strand = Plus / Plus
Query: 175 tggttcatgtcactttttatctgcatttttgctacaagcatcctnnnaatgagatggagt 234
|||| |||||||||||| ||||||||||| ||||| | || || |||||||||| |
Sbjct: 269 tggtacatgtcacttttcatctgcattttcgctacgggtattctggaaatgagatgggct 328
Query: 235 ggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcc 294
|||| | |||| ||||||||||| || |||||||||||||||||||||||||| ||
Sbjct: 329 cgtgtcgcagttgacgattggtggagaaacgagcagttctgggtcattggaggtgtctct 388
Query: 295 tcgcacctcttcgctgtgtttcagggacttctcnnggtcatagctggtgttgatacaagc 354
| || || || || ||||| || ||||||||| ||| ||||||||||| || || |||
Sbjct: 389 gcccatctatttgccgtgttccaaggacttctcaaggtgatagctggtgtggacactagc 448
Query: 355 tncactnngacatcaaagggtggagatgatgacgaattctcagagctgta 404
| ||| ||| |||||| ||||||||||| || || || ||||||||
Sbjct: 449 ttcaccgtcacaacaaaggccggagatgatgaggagttttctgagctgta 498
>gb|BI779022.2|BI779022 EBro01_SQ002_J19_R root, 3 week, hydroponic grown, no treatment, cv
Optic, EBro01 Hordeum vulgare subsp. vulgare cDNA clone
EBro01_SQ002_J19 5', mRNA sequence
Length = 439
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 197 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 256
Query: 283 ggaggt 288
||||||
Sbjct: 257 ggaggt 262
>gb|BU971759.1|BU971759 HB19J12r BC Hordeum vulgare subsp. vulgare cDNA clone HB19J12
5-PRIME, mRNA sequence
Length = 649
Score = 91.7 bits (46), Expect = 2e-017
Identities = 182/230 (79%)
Strand = Plus / Plus
Query: 175 tggttcatgtcactttttatctgcatttttgctacaagcatcctnnnaatgagatggagt 234
|||| |||||||||||| ||||||||||| ||||| | || || |||||||||| |
Sbjct: 136 tggtacatgtcacttttcatctgcattttcgctacgggtattctggaaatgagatgggct 195
Query: 235 ggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcc 294
|||| | |||| ||||||||||| || |||||||||||||||||||||||||| ||
Sbjct: 196 cgtgtcgcagttgacgattggtggagaaacgagcagttctgggtcattggaggtgtctct 255
Query: 295 tcgcacctcttcgctgtgtttcagggacttctcnnggtcatagctggtgttgatacaagc 354
| || || || || ||||| || ||||||||| ||| ||||||||||| || || |||
Sbjct: 256 gcccatctatttgccgtgttccaaggacttctcaaggtgatagctggtgtggacactagc 315
Query: 355 tncactnngacatcaaagggtggagatgatgacgaattctcagagctgta 404
| ||| ||| |||||| ||||||||||| || || || ||||||||
Sbjct: 316 ttcaccgtcacaacaaaggccggagatgatgaggagttttctgagctgta 365
>gb|CA012990.1|CA012990 HT07B01r HT Hordeum vulgare subsp. vulgare cDNA clone HT07B01
5-PRIME, mRNA sequence
Length = 579
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 291 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 350
Query: 283 ggaggt 288
||||||
Sbjct: 351 ggaggt 356
>gb|BU990492.1|BU990492 HF25D10r HF Hordeum vulgare subsp. vulgare cDNA clone HF25D10
5-PRIME, mRNA sequence
Length = 621
Score = 87.7 bits (44), Expect = 3e-016
Identities = 56/60 (93%)
Strand = Plus / Plus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggaggt 288
|||||||||||||| ||||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 12 tggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcattggaggt 71
>gb|AV927219.1|AV927219 AV927219 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd1a04 3', mRNA sequence
Length = 588
Score = 83.8 bits (42), Expect = 4e-015
Identities = 130/161 (80%)
Strand = Plus / Minus
Query: 245 ttgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctct 304
|||| ||||||||||| || |||||||||||||||||||||||||| || | || || |
Sbjct: 582 ttgacgattggtggagaaacgagcagttctgggtcattggaggtgtctctgcccatctat 523
Query: 305 tcgctgtgtttcagggacttctcnnggtcatagctggtgttgatacaagctncactnnga 364
| || ||||| || ||||||||| ||| ||||||||||| || || |||| ||| |
Sbjct: 522 ttgccgtgttccaaggacttctcaaggtgatagctggtgtggacactagcttcaccgtca 463
Query: 365 catcaaagggtggagatgatgacgaattctcagagctgtac 405
|| |||||| ||||||||||| || || || |||||||||
Sbjct: 462 caacaaaggccggagatgatgaggagttttctgagctgtac 422
>gb|BJ464018.1|BJ464018 BJ464018 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags31h15 5', mRNA sequence
Length = 419
Score = 83.8 bits (42), Expect = 4e-015
Identities = 57/62 (91%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct: 358 atgaggtggagtggtgttggcattgacgagtggtggaggaatgaacagttctgggtcatt 417
Query: 283 gg 284
||
Sbjct: 418 gg 419
>gb|CA025840.1|CA025840 HZ53E19r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ53E19
5-PRIME, mRNA sequence
Length = 456
Score = 81.8 bits (41), Expect = 2e-014
Identities = 129/160 (80%)
Strand = Plus / Plus
Query: 245 ttgatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctct 304
|||| ||||||||||| || |||||||||||||||||||||||||| || | || || |
Sbjct: 4 ttgacgattggtggagaaacgagcagttctgggtcattggaggtgtctctgcccatctat 63
Query: 305 tcgctgtgtttcagggacttctcnnggtcatagctggtgttgatacaagctncactnnga 364
| || ||||| || ||||||||| ||| ||||||||||| || || |||| ||| |
Sbjct: 64 ttgccgtgttccaaggacttctcaaggtgatagctggtgtggacactagcttcaccgtca 123
Query: 365 catcaaagggtggagatgatgacgaattctcagagctgta 404
|| |||||| ||||||||||| || || || ||||||||
Sbjct: 124 caacaaaggccggagatgatgaggagttttctgagctgta 163
>gb|BQ739972.1|BQ739972 HB107G12 HB Hordeum vulgare subsp. vulgare cDNA clone HB107G12
similar to (AF200533) cellulose synthase-9 [Zea mays],
mRNA sequence
Length = 623
Score = 69.9 bits (35), Expect = 6e-011
Identities = 59/67 (88%)
Strand = Plus / Plus
Query: 222 aatgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcat 281
|||||| |||||||||||||| ||||| | |||||||||| || ||||||||||||||
Sbjct: 417 aatgaggtggagtggtgttggcattgaccaggggtggaggaaagaacagttctgggtcat 476
Query: 282 tggaggt 288
|||||||
Sbjct: 477 tggaggt 483
>gb|AV925770.1|AV925770 AV925770 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd25l19 5', mRNA sequence
Length = 425
Score = 67.9 bits (34), Expect = 3e-010
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| ||||| |||||||| || || || |||||||||||||| ||||||||||||||
Sbjct: 75 atgaggtggagcggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatc 134
Query: 283 ggaggt 288
||||||
Sbjct: 135 ggaggt 140
>gb|AV926207.1|AV926207 AV926207 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd18i05 5', mRNA sequence
Length = 668
Score = 67.9 bits (34), Expect = 3e-010
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| ||||| |||||||| || || || |||||||||||||| ||||||||||||||
Sbjct: 342 atgaggtggagcggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatc 401
Query: 283 ggaggt 288
||||||
Sbjct: 402 ggaggt 407
>gb|AV926208.1|AV926208 AV926208 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd18i06 5', mRNA sequence
Length = 586
Score = 67.9 bits (34), Expect = 3e-010
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| ||||| |||||||| || || || |||||||||||||| ||||||||||||||
Sbjct: 336 atgaggtggagcggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatc 395
Query: 283 ggaggt 288
||||||
Sbjct: 396 ggaggt 401
>gb|BQ468619.1|BQ468619 HM01M13T HM Hordeum vulgare subsp. vulgare cDNA clone HM01M13
5-PRIME, mRNA sequence
Length = 653
Score = 67.9 bits (34), Expect = 3e-010
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| ||||| |||||||| || || || |||||||||||||| ||||||||||||||
Sbjct: 96 atgaggtggagcggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatc 155
Query: 283 ggaggt 288
||||||
Sbjct: 156 ggaggt 161
>gb|BI776485.2|BI776485 EBpi05_SQ001_J01_R pistil, 8 DPA, no treatment, cv Optic, EBpi05
Hordeum vulgare subsp. vulgare cDNA clone
EBpi05_SQ001_J01 5', mRNA sequence
Length = 518
Score = 67.9 bits (34), Expect = 3e-010
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| ||||| |||||||| || || || |||||||||||||| ||||||||||||||
Sbjct: 7 atgaggtggagcggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatc 66
Query: 283 ggaggt 288
||||||
Sbjct: 67 ggaggt 72
>gb|BU984513.1|BU984513 HF04C11r HF Hordeum vulgare subsp. vulgare cDNA clone HF04C11
5-PRIME, mRNA sequence
Length = 629
Score = 67.9 bits (34), Expect = 3e-010
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| ||||| |||||||| || || || |||||||||||||| ||||||||||||||
Sbjct: 409 atgaggtggagcggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatc 468
Query: 283 ggaggt 288
||||||
Sbjct: 469 ggaggt 474
>gb|BU986849.1|BU986849 HF13B10r HF Hordeum vulgare subsp. vulgare cDNA clone HF13B10
5-PRIME, mRNA sequence
Length = 622
Score = 67.9 bits (34), Expect = 3e-010
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| ||||| |||||||| || || || |||||||||||||| ||||||||||||||
Sbjct: 168 atgaggtggagcggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatc 227
Query: 283 ggaggt 288
||||||
Sbjct: 228 ggaggt 233
>gb|BU988138.1|BU988138 HF16M09r HF Hordeum vulgare subsp. vulgare cDNA clone HF16M09
5-PRIME, mRNA sequence
Length = 643
Score = 67.9 bits (34), Expect = 3e-010
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| ||||| |||||||| || || || |||||||||||||| ||||||||||||||
Sbjct: 265 atgaggtggagcggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatc 324
Query: 283 ggaggt 288
||||||
Sbjct: 325 ggaggt 330
>gb|CA025257.1|CA025257 HZ51J24r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ51J24
5-PRIME, mRNA sequence
Length = 463
Score = 67.9 bits (34), Expect = 3e-010
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| ||||| |||||||| || || || |||||||||||||| ||||||||||||||
Sbjct: 85 atgaggtggagcggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatc 144
Query: 283 ggaggt 288
||||||
Sbjct: 145 ggaggt 150
>gb|CB876338.1|CB876338 HX10P19w HX Hordeum vulgare subsp. vulgare cDNA clone HX10P19
3-PRIME, mRNA sequence
Length = 616
Score = 67.9 bits (34), Expect = 3e-010
Identities = 58/66 (87%)
Strand = Plus / Minus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| ||||| |||||||| || || || |||||||||||||| ||||||||||||||
Sbjct: 609 atgaggtggagcggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatc 550
Query: 283 ggaggt 288
||||||
Sbjct: 549 ggaggt 544
>gb|AV913277.1|AV913277 AV913277 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21i03 5', mRNA sequence
Length = 631
Score = 63.9 bits (32), Expect = 4e-009
Identities = 35/36 (97%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggt 288
|||||||||||||| |||||||||||||||||||||
Sbjct: 16 tggtggaggaatgaacagttctgggtcattggaggt 51
>gb|AV913278.1|AV913278 AV913278 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21i04 5', mRNA sequence
Length = 604
Score = 63.9 bits (32), Expect = 4e-009
Identities = 35/36 (97%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggt 288
|||||||||||||| |||||||||||||||||||||
Sbjct: 15 tggtggaggaatgaacagttctgggtcattggaggt 50
>gb|BQ465284.1|BQ465284 HU03C22r HU Hordeum vulgare subsp. vulgare cDNA clone HU03C22
5-PRIME, mRNA sequence
Length = 643
Score = 63.9 bits (32), Expect = 4e-009
Identities = 35/36 (97%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggt 288
|||||||||||||| |||||||||||||||||||||
Sbjct: 14 tggtggaggaatgaacagttctgggtcattggaggt 49
>gb|AV931092.1|AV931092 AV931092 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd18i05 3', mRNA sequence
Length = 658
Score = 60.0 bits (30), Expect = 6e-008
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 235 ggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggaggt 288
|||||||| || || || |||||||||||||| |||||||||||||| ||||||
Sbjct: 654 ggtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatcggaggt 601
>gb|BG417165.1|BG417165 HVSMEk0016J06f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0016J06f, mRNA sequence
Length = 475
Score = 58.0 bits (29), Expect = 2e-007
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 236 gtgttgggattgatgattggtggaggaatgagcagttctgggtcattggaggt 288
||||||| || || || |||||||||||||| |||||||||||||| ||||||
Sbjct: 364 gtgttggcatcgacgagtggtggaggaatgaacagttctgggtcatcggaggt 416
>gb|AV931093.1|AV931093 AV931093 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd18i06 3', mRNA sequence
Length = 658
Score = 56.0 bits (28), Expect = 1e-006
Identities = 34/36 (94%)
Strand = Plus / Minus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggt 288
|||||||||||||| |||||||||||||| ||||||
Sbjct: 643 tggtggaggaatgaacagttctgggtcatcggaggt 608
>gb|BU967242.1|BU967242 HB03K11r BC Hordeum vulgare subsp. vulgare cDNA clone HB03K11
5-PRIME, mRNA sequence
Length = 577
Score = 56.0 bits (28), Expect = 1e-006
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggt 288
|||||||||||||| |||||||||||||| ||||||
Sbjct: 31 tggtggaggaatgaacagttctgggtcatcggaggt 66
>gb|CB860194.1|CB860194 HI12P13w HI Hordeum vulgare subsp. vulgare cDNA clone HI12P13
3-PRIME, mRNA sequence
Length = 651
Score = 56.0 bits (28), Expect = 1e-006
Identities = 34/36 (94%)
Strand = Plus / Minus
Query: 253 tggtggaggaatgagcagttctgggtcattggaggt 288
|||||||||||||| |||||||||||||| ||||||
Sbjct: 636 tggtggaggaatgaacagttctgggtcatcggaggt 601
>gb|AL503512.1|AL503512 AL503512 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW02G16T 5', mRNA sequence
Length = 700
Score = 52.0 bits (26), Expect = 1e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||| || || || || |||||||| || |||||||| |||||||||||
Sbjct: 136 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttttgggtcattgg 193
>gb|BF258638.2|BF258638 HVSMEf0016E13f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0016E13f, mRNA sequence
Length = 578
Score = 52.0 bits (26), Expect = 1e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||| || || || || |||||||| || |||||||||||||| |||||
Sbjct: 242 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttctgggttattgg 299
>gb|BF064711.2|BF064711 HV_CEb0017G02f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0017G02f, mRNA sequence
Length = 812
Score = 52.0 bits (26), Expect = 1e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||| || || || || |||||||| || |||||||| |||||||||||
Sbjct: 405 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttttgggtcattgg 462
>gb|BJ453328.1|BJ453328 BJ453328 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak42j03 5', mRNA sequence
Length = 685
Score = 52.0 bits (26), Expect = 1e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||| || || || || |||||||| || |||||||| |||||||||||
Sbjct: 317 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttttgggtcattgg 374
>gb|BQ467842.1|BQ467842 HR01B16r HR Hordeum vulgare subsp. vulgare cDNA clone HR01B16
5-PRIME, mRNA sequence
Length = 498
Score = 52.0 bits (26), Expect = 1e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||| || || || || |||||||| || |||||||| |||||||||||
Sbjct: 211 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttttgggtcattgg 268
>gb|BM376392.2|BM376392 EBem05_SQ002_B14_R embryo, 14 DPA, no treatment, cv Optic, EBem05
Hordeum vulgare subsp. vulgare cDNA clone
EBem05_SQ002_B14 5', mRNA sequence
Length = 555
Score = 52.0 bits (26), Expect = 1e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||| || || || || |||||||| || |||||||||||||| |||||
Sbjct: 270 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttctgggttattgg 327
>gb|BU972673.1|BU972673 HB22G06r BC Hordeum vulgare subsp. vulgare cDNA clone HB22G06
5-PRIME, mRNA sequence
Length = 655
Score = 52.0 bits (26), Expect = 1e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||| || || || || |||||||| || |||||||| |||||||||||
Sbjct: 469 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttttgggtcattgg 526
>gb|BU985115.1|BU985115 HF06C19r HF Hordeum vulgare subsp. vulgare cDNA clone HF06C19
5-PRIME, mRNA sequence
Length = 548
Score = 52.0 bits (26), Expect = 1e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||| || || || || |||||||| || |||||||| |||||||||||
Sbjct: 277 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttttgggtcattgg 334
>gb|CA030609.1|CA030609 HX07J05r HX Hordeum vulgare subsp. vulgare cDNA clone HX07J05
5-PRIME, mRNA sequence
Length = 617
Score = 52.0 bits (26), Expect = 1e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||| || || || || |||||||| || |||||||| |||||||||||
Sbjct: 144 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttttgggtcattgg 201
>gb|CA030647.1|CA030647 HX07L05r HX Hordeum vulgare subsp. vulgare cDNA clone HX07L05
5-PRIME, mRNA sequence
Length = 638
Score = 52.0 bits (26), Expect = 1e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattgg 284
||||||||||||| || || || || |||||||| || |||||||| |||||||||||
Sbjct: 144 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttttgggtcattgg 201
>gb|BG365821.2|BG365821 HVSMEi0004F18f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0004F18f, mRNA sequence
Length = 888
Score = 50.1 bits (25), Expect = 6e-005
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcat 281
|||||||||||||||||||||||| ||||
Sbjct: 304 tggtggaggaatgagcagttctggctcat 332
>gb|BM817226.1|BM817226 HC109A10_T3.ab1 HC Hordeum vulgare subsp. vulgare cDNA clone
HC109A10_T3.ab1 similar to (AC009525) Very similar to
cellulose synthase catalytic subunit [Arabidopsis
thaliana], mRNA sequence
Length = 927
Score = 50.1 bits (25), Expect = 6e-005
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcat 281
|||||||||||||||||||||||| ||||
Sbjct: 157 tggtggaggaatgagcagttctggctcat 185
>gb|BG343963.1|BG343963 HVSMEg0007D23f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0007D23f, mRNA sequence
Length = 786
Score = 48.1 bits (24), Expect = 2e-004
Identities = 45/52 (86%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggt 278
||||||||||||| || || || || |||||||| || ||||||||||||||
Sbjct: 707 gatggagtggtgtcggcatcgaggactggtggagaaacgagcagttctgggt 758
>gb|BG369245.1|BG369245 HVSMEi0023G07f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0023G07f, mRNA sequence
Length = 813
Score = 46.1 bits (23), Expect = 0.001
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 175 tggttcatgtcactttttatctgcatttttgctac 209
|||| |||||||||||| ||||||||||| |||||
Sbjct: 109 tggtacatgtcacttttcatctgcattttcgctac 143
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 49,210
Number of Sequences: 312970
Number of extensions: 49210
Number of successful extensions: 16935
Number of sequences better than 0.5: 61
Number of HSP's better than 0.5 without gapping: 61
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16857
Number of HSP's gapped (non-prelim): 73
length of query: 425
length of database: 175,134,539
effective HSP length: 18
effective length of query: 407
effective length of database: 169,501,079
effective search space: 68986939153
effective search space used: 68986939153
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)