BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= MAD56_a5f4.3.2
(1520 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL503448.1|AL503448 AL503448 Hordeum vulgare Barke roots... 60 2e-007
gb|AL504492.1|AL504492 AL504492 Hordeum vulgare Barke roots... 60 2e-007
gb|AL505426.1|AL505426 AL505426 Hordeum vulgare Barke roots... 60 2e-007
gb|AL505906.1|AL505906 AL505906 Hordeum vulgare Barke roots... 60 2e-007
gb|AL507081.1|AL507081 AL507081 Hordeum vulgare Barke devel... 60 2e-007
gb|AL508652.1|AL508652 AL508652 Hordeum vulgare Barke devel... 60 2e-007
gb|BF629361.2|BF629361 HVSMEb0010P14f Hordeum vulgare seedl... 60 2e-007
gb|BF255336.2|BF255336 HVSMEf0006J09f Hordeum vulgare seedl... 60 2e-007
gb|BF256101.2|BF256101 HVSMEf0008L23f Hordeum vulgare seedl... 60 2e-007
gb|BI954469.1|BI954469 HVSMEm0018B19f Hordeum vulgare green... 60 2e-007
gb|BI956944.1|BI956944 HVSMEn0006E12f Hordeum vulgare rachi... 60 2e-007
gb|BI957027.1|BI957027 HVSMEn0007B02f Hordeum vulgare rachi... 60 2e-007
gb|BI957037.1|BI957037 HVSMEn0007B14f Hordeum vulgare rachi... 60 2e-007
gb|BI958385.1|BI958385 HVSMEn0014L20f Hordeum vulgare rachi... 60 2e-007
gb|BI959417.1|BI959417 HVSMEn0019J10f Hordeum vulgare rachi... 60 2e-007
gb|BI959431.1|BI959431 HVSMEn0019K08f Hordeum vulgare rachi... 60 2e-007
gb|BG300532.2|BG300532 HVSMEb0017G05f Hordeum vulgare seedl... 60 2e-007
gb|BQ462582.1|BQ462582 HI01F21T HI Hordeum vulgare subsp. v... 60 2e-007
gb|BQ462871.1|BQ462871 HI02E11r HI Hordeum vulgare subsp. v... 60 2e-007
gb|BQ462985.1|BQ462985 HI02K13r HI Hordeum vulgare subsp. v... 60 2e-007
gb|BQ463825.1|BQ463825 HG01I22r HG Hordeum vulgare subsp. v... 60 2e-007
gb|BQ469563.1|BQ469563 HZ01C22r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|BQ469691.1|BQ469691 HZ01J07r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|BQ471155.1|BQ471155 HV01D23T HV Hordeum vulgare subsp. v... 60 2e-007
gb|BQ739796.1|BQ739796 HB03B08 HB Hordeum vulgare subsp. vu... 60 2e-007
gb|BQ739930.1|BQ739930 HB05C05 HB Hordeum vulgare subsp. vu... 60 2e-007
gb|BM097048.2|BM097048 EBpi07_SQ002_D20_R pistil, 12 DPA, n... 60 2e-007
gb|BM370467.2|BM370467 EBro08_SQ004_F03_R root, 3 week, dro... 60 2e-007
gb|BQ764714.1|BQ764714 EBca01_SQ004_N14_R carpel, pre-anthe... 60 2e-007
gb|BQ764738.1|BQ764738 EBca01_SQ004_C20_R carpel, pre-anthe... 60 2e-007
gb|BQ766448.1|BQ766448 EBro08_SQ006_G04_R root, 3 week, dro... 60 2e-007
gb|BQ766550.1|BQ766550 EBro08_SQ006_M08_R root, 3 week, dro... 60 2e-007
gb|BU978796.1|BU978796 HA14E18r HA Hordeum vulgare subsp. v... 60 2e-007
gb|BU998577.1|BU998577 HI11H24r HI Hordeum vulgare subsp. v... 60 2e-007
gb|CA018242.1|CA018242 HV08A20r HV Hordeum vulgare subsp. v... 60 2e-007
gb|CA019961.1|CA019961 HV13O21r HV Hordeum vulgare subsp. v... 60 2e-007
gb|CA020452.1|CA020452 HZ36F18r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA020490.1|CA020490 HZ36H14r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA020504.1|CA020504 HZ36I05r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA020509.1|CA020509 HZ36I10r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA020797.1|CA020797 HZ37L23r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA021207.1|CA021207 HZ39G22r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA021345.1|CA021345 HZ39N05r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA021424.1|CA021424 HZ40B03r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA022132.1|CA022132 HZ42E03r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA022223.1|CA022223 HZ42I04r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA022589.1|CA022589 HZ43L15r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA022592.1|CA022592 HZ43L18r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA022610.1|CA022610 HZ43N05r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA022683.1|CA022683 HZ44B01r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA022707.1|CA022707 HZ44C04r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA022792.1|CA022792 HZ44F22r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA022924.1|CA022924 HZ44L21r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA023210.1|CA023210 HZ45I24r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA023438.1|CA023438 HZ46D23r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA023590.1|CA023590 HZ46L21r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA023679.1|CA023679 HZ47A18r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA024073.1|CA024073 HZ48E15r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA024079.1|CA024079 HZ48E21r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA024381.1|CA024381 HZ49C11r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA024879.1|CA024879 HZ50J05r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA025002.1|CA025002 HZ50P01r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA025411.1|CA025411 HZ52B11r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA025719.1|CA025719 HZ52P07r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA025724.1|CA025724 HZ52P12r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA026009.1|CA026009 HZ53N03r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA026017.1|CA026017 HZ53N15r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA026066.1|CA026066 HZ53P19r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA026295.1|CA026295 HZ55H24r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA027438.1|CA027438 HZ58O20r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA027542.1|CA027542 HZ59E05r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA027661.1|CA027661 HZ59K04r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA027797.1|CA027797 HZ60A24r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA027921.1|CA027921 HZ60H05r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA028044.1|CA028044 HZ60N05r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA028102.1|CA028102 HZ61A02r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA028294.1|CA028294 HZ61I24r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA028299.1|CA028299 HZ61J05r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA028950.1|CA028950 HZ63L15r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CA029655.1|CA029655 HZ65N07r HZ Hordeum vulgare subsp. v... 60 2e-007
gb|CB882801.1|CB882801 HL02O03w HL Hordeum vulgare subsp. v... 60 2e-007
gb|CB883088.1|CB883088 HQ01C16w HQ Hordeum vulgare subsp. v... 60 2e-007
gb|AV833813.1|AV833813 AV833813 K. Sato unpublished cDNA li... 58 9e-007
gb|BI956940.1|BI956940 HVSMEn0006D20f Hordeum vulgare rachi... 56 4e-006
gb|BF621492.1|BF621492 HVSMEa0011C21f Hordeum vulgare seedl... 52 6e-005
gb|BI959444.1|BI959444 HVSMEn0019L05f Hordeum vulgare rachi... 48 9e-004
gb|BI959830.1|BI959830 HVSMEn0021N12f Hordeum vulgare rachi... 48 9e-004
gb|BG344189.2|BG344189 HVSMEg0008A10f Hordeum vulgare pre-a... 48 9e-004
gb|BJ463222.1|BJ463222 BJ463222 K. Sato unpublished cDNA li... 48 9e-004
gb|CA023872.1|CA023872 HZ47K17r HZ Hordeum vulgare subsp. v... 48 9e-004
gb|AL501424.1|AL501424 AL501424 Hordeum vulgare Barke roots... 46 0.003
gb|AL501810.1|AL501810 AL501810 Hordeum vulgare Barke roots... 46 0.003
gb|AL502694.1|AL502694 AL502694 Hordeum vulgare Barke roots... 46 0.003
gb|AL507965.1|AL507965 AL507965 Hordeum vulgare Barke devel... 46 0.003
gb|AL510662.1|AL510662 AL510662 Hordeum vulgare Barke devel... 46 0.003
gb|BF261108.2|BF261108 HVSMEf0023M12f Hordeum vulgare seedl... 46 0.003
gb|BI959188.1|BI959188 HVSMEn0018I19f Hordeum vulgare rachi... 46 0.003
gb|AV910070.1|AV910070 AV910070 K. Sato unpublished cDNA li... 46 0.003
gb|AV912164.1|AV912164 AV912164 K. Sato unpublished cDNA li... 46 0.003
gb|AV917175.1|AV917175 AV917175 K. Sato unpublished cDNA li... 46 0.003
gb|AV918195.1|AV918195 AV918195 K. Sato unpublished cDNA li... 46 0.003
gb|AV919904.1|AV919904 AV919904 K. Sato unpublished cDNA li... 46 0.003
gb|AV922270.1|AV922270 AV922270 K. Sato unpublished cDNA li... 46 0.003
gb|BM816773.1|BM816773 HC02H07_T3.ab1 HC Hordeum vulgare su... 46 0.003
gb|BJ449243.1|BJ449243 BJ449243 K. Sato unpublished cDNA li... 46 0.003
gb|BJ458781.1|BJ458781 BJ458781 K. Sato unpublished cDNA li... 46 0.003
gb|BJ460883.1|BJ460883 BJ460883 K. Sato unpublished cDNA li... 46 0.003
gb|BJ467254.1|BJ467254 BJ467254 K. Sato unpublished cDNA li... 46 0.003
gb|BQ659997.1|BQ659997 HG01I22u HG Hordeum vulgare subsp. v... 46 0.003
gb|BQ664037.1|BQ664037 HV01D23w HV Hordeum vulgare subsp. v... 46 0.003
gb|BQ665806.1|BQ665806 HZ01C22u HZ Hordeum vulgare subsp. v... 46 0.003
gb|BQ665920.1|BQ665920 HZ01J07u HZ Hordeum vulgare subsp. v... 46 0.003
gb|BM100272.2|BM100272 EBma01_SQ001_L07_R maternal, 4 DPA, ... 46 0.003
gb|BM376151.2|BM376151 EBma01_SQ002_I03_R maternal, 4 DPA, ... 46 0.003
gb|BI781057.2|BI781057 EBma03_SQ001_E15_R maternal, 8 DPA, ... 46 0.003
gb|BI777039.2|BI777039 EBpi03_SQ001_L15_R pistil, 4 DPA, no... 46 0.003
gb|BM097960.2|BM097960 EBpi03_SQ002_C14_R pistil, 4 DPA, no... 46 0.003
gb|BI778132.2|BI778132 EBro07_SQ002_F03_R root, 3 week, red... 46 0.003
gb|BQ754289.1|BQ754289 EBca01_SQ003_H09_R carpel, pre-anthe... 46 0.003
gb|BQ757085.1|BQ757085 EBem10_SQ002_M09_R embryo, 2 Day ger... 46 0.003
gb|BQ764746.1|BQ764746 EBca01_SQ004_D22_R carpel, pre-anthe... 46 0.003
gb|BQ764973.1|BQ764973 EBca01_SQ005_M11_R carpel, pre-anthe... 46 0.003
gb|BU966826.1|BU966826 HB02H15r BC Hordeum vulgare subsp. v... 46 0.003
gb|CA016619.1|CA016619 HV08A20u HV Hordeum vulgare subsp. v... 46 0.003
gb|CA020459.1|CA020459 HZ36G02r HZ Hordeum vulgare subsp. v... 46 0.003
gb|CA021346.1|CA021346 HZ39N06r HZ Hordeum vulgare subsp. v... 46 0.003
gb|CA021383.1|CA021383 HZ39P01r HZ Hordeum vulgare subsp. v... 46 0.003
gb|CA025431.1|CA025431 HZ52C10r HZ Hordeum vulgare subsp. v... 46 0.003
gb|CA025671.1|CA025671 HZ52M14r HZ Hordeum vulgare subsp. v... 46 0.003
gb|CA026101.1|CA026101 HZ54J15r HZ Hordeum vulgare subsp. v... 46 0.003
gb|CA027046.1|CA027046 HZ57L22r HZ Hordeum vulgare subsp. v... 46 0.003
gb|CA027249.1|CA027249 HZ58F08r HZ Hordeum vulgare subsp. v... 46 0.003
gb|CA028550.1|CA028550 HZ62G08r HZ Hordeum vulgare subsp. v... 46 0.003
gb|CA029205.1|CA029205 HZ64I10r HZ Hordeum vulgare subsp. v... 46 0.003
gb|CA029415.1|CA029415 HZ65C10r HZ Hordeum vulgare subsp. v... 46 0.003
gb|BI956693.1|BI956693 HVSMEn0004M24f Hordeum vulgare rachi... 44 0.013
gb|AL503151.1|AL503151 AL503151 Hordeum vulgare Barke roots... 42 0.053
gb|BF625454.3|BF625454 HVSMEa0009F04f Hordeum vulgare seedl... 42 0.053
gb|AL509877.1|AL509877 AL509877 Hordeum vulgare Barke devel... 40 0.21
gb|BG342958.1|BG342958 HVSMEg0001H16f Hordeum vulgare pre-a... 40 0.21
>gb|AL503448.1|AL503448 AL503448 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW02C24T 5', mRNA sequence
Length = 700
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 411 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 470
Query: 585 ctcacg 590
||||||
Sbjct: 471 ctcacg 476
>gb|AL504492.1|AL504492 AL504492 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW05H06V 5', mRNA sequence
Length = 699
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 396 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 455
Query: 585 ctcacg 590
||||||
Sbjct: 456 ctcacg 461
>gb|AL505426.1|AL505426 AL505426 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW08G23V 5', mRNA sequence
Length = 682
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 288 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 347
Query: 585 ctcacg 590
||||||
Sbjct: 348 ctcacg 353
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 448 tcagcggcggcggcaacgacttctccgccttc 479
>gb|AL505906.1|AL505906 AL505906 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW09N24V 5', mRNA sequence
Length = 500
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 405 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 464
Query: 585 ctcacg 590
||||||
Sbjct: 465 ctcacg 470
>gb|AL507081.1|AL507081 AL507081 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY05E16T 5',
mRNA sequence
Length = 700
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 411 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 470
Query: 585 ctcacg 590
||||||
Sbjct: 471 ctcacg 476
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 571 tcagcggcggcggcaacgacttctccgccttc 602
>gb|AL508652.1|AL508652 AL508652 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY09G11V 5',
mRNA sequence
Length = 664
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 412 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 471
Query: 585 ctcacg 590
||||||
Sbjct: 472 ctcacg 477
Score = 44.1 bits (22), Expect = 0.013
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 693 gccggcggcaatgacttctccgcctt 718
||||||||||| ||||||||||||||
Sbjct: 579 gccggcggcaacgacttctccgcctt 604
>gb|BF629361.2|BF629361 HVSMEb0010P14f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0010P14f, mRNA sequence
Length = 732
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 401 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 460
Query: 585 ctcacg 590
||||||
Sbjct: 461 ctcacg 466
>gb|BF255336.2|BF255336 HVSMEf0006J09f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0006J09f, mRNA sequence
Length = 585
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 393 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 452
Query: 585 ctcacg 590
||||||
Sbjct: 453 ctcacg 458
>gb|BF256101.2|BF256101 HVSMEf0008L23f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0008L23f, mRNA sequence
Length = 798
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 180 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 239
Query: 585 ctcacg 590
||||||
Sbjct: 240 ctcacg 245
>gb|BI954469.1|BI954469 HVSMEm0018B19f Hordeum vulgare green seedling EST library
HVcDNA0014 (Blumeria infected) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEm0018B19f, mRNA sequence
Length = 671
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 235 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 294
Query: 585 ctcacg 590
||||||
Sbjct: 295 ctcacg 300
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 395 tcagcggcggcggcaacgacttctccgccttc 426
>gb|BI956944.1|BI956944 HVSMEn0006E12f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0006E12f, mRNA sequence
Length = 857
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 69 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 128
Query: 585 ctcacg 590
||||||
Sbjct: 129 ctcacg 134
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 229 tcagcggcggcggcaacgacttctccgccttc 260
Score = 42.1 bits (21), Expect = 0.053
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 1152 tacatgttctgggacatgctacatcctacgca 1183
|||||||||||||||||||| || || |||||
Sbjct: 690 tacatgttctgggacatgcttcancccacgca 721
>gb|BI957027.1|BI957027 HVSMEn0007B02f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0007B02f, mRNA sequence
Length = 870
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 369 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 428
Query: 585 ctcacg 590
||||||
Sbjct: 429 ctcacg 434
>gb|BI957037.1|BI957037 HVSMEn0007B14f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0007B14f, mRNA sequence
Length = 859
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 361 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 420
Query: 585 ctcacg 590
||||||
Sbjct: 421 ctcacg 426
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 521 tcagcggcggcggcaacgacttctccgccttc 552
>gb|BI958385.1|BI958385 HVSMEn0014L20f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0014L20f, mRNA sequence
Length = 654
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 397 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 456
Query: 585 ctcacg 590
||||||
Sbjct: 457 ctcacg 462
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 557 tcagcggcggcggcaacgacttctccgccttc 588
>gb|BI959417.1|BI959417 HVSMEn0019J10f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0019J10f, mRNA sequence
Length = 673
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 386 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 445
Query: 585 ctcacg 590
||||||
Sbjct: 446 ctcacg 451
>gb|BI959431.1|BI959431 HVSMEn0019K08f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0019K08f, mRNA sequence
Length = 657
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 398 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 457
Query: 585 ctcacg 590
||||||
Sbjct: 458 ctcacg 463
>gb|BG300532.2|BG300532 HVSMEb0017G05f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0017G05f, mRNA sequence
Length = 882
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 395 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 454
Query: 585 ctcacg 590
||||||
Sbjct: 455 ctcacg 460
>gb|BQ462582.1|BQ462582 HI01F21T HI Hordeum vulgare subsp. vulgare cDNA clone HI01F21
5-PRIME, mRNA sequence
Length = 526
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 388 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 447
Query: 585 ctcacg 590
||||||
Sbjct: 448 ctcacg 453
>gb|BQ462871.1|BQ462871 HI02E11r HI Hordeum vulgare subsp. vulgare cDNA clone HI02E11
5-PRIME, mRNA sequence
Length = 683
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 129 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 188
Query: 585 ctcacg 590
||||||
Sbjct: 189 ctcacg 194
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 289 tcagcggcggcggcaacgacttctccgccttc 320
>gb|BQ462985.1|BQ462985 HI02K13r HI Hordeum vulgare subsp. vulgare cDNA clone HI02K13
5-PRIME, mRNA sequence
Length = 586
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 401 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 460
Query: 585 ctcacg 590
||||||
Sbjct: 461 ctcacg 466
>gb|BQ463825.1|BQ463825 HG01I22r HG Hordeum vulgare subsp. vulgare cDNA clone HG01I22
5-PRIME, mRNA sequence
Length = 496
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 130 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 189
Query: 585 ctcacg 590
||||||
Sbjct: 190 ctcacg 195
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 290 tcagcggcggcggcaacgacttctccgccttc 321
>gb|BQ469563.1|BQ469563 HZ01C22r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ01C22
5-PRIME, mRNA sequence
Length = 475
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 407 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 466
Query: 585 ctcacg 590
||||||
Sbjct: 467 ctcacg 472
>gb|BQ469691.1|BQ469691 HZ01J07r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ01J07
5-PRIME, mRNA sequence
Length = 450
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 382 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 441
Query: 585 ctcacg 590
||||||
Sbjct: 442 ctcacg 447
>gb|BQ471155.1|BQ471155 HV01D23T HV Hordeum vulgare subsp. vulgare cDNA clone HV01D23
5-PRIME, mRNA sequence
Length = 590
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 407 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 466
Query: 585 ctcacg 590
||||||
Sbjct: 467 ctcacg 472
>gb|BQ739796.1|BQ739796 HB03B08 HB Hordeum vulgare subsp. vulgare cDNA clone HB03B08
similar to NP_198322.1| (NM_122861) putative protein
[Arabidopsis thaliana], mRNA sequence
Length = 672
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 403 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 462
Query: 585 ctcacg 590
||||||
Sbjct: 463 ctcacg 468
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||| ||||| |||||||||||||||
Sbjct: 563 tcagcggcgggggcaacgacttctccgccttc 594
>gb|BQ739930.1|BQ739930 HB05C05 HB Hordeum vulgare subsp. vulgare cDNA clone HB05C05
similar to NP_198322.1| (NM_122861) putative protein
[Arabidopsis thaliana], mRNA sequence
Length = 672
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 403 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 462
Query: 585 ctcacg 590
||||||
Sbjct: 463 ctcacg 468
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||| ||||| |||||||||||||||
Sbjct: 563 tcagcggcgggggcaacgacttctccgccttc 594
>gb|BM097048.2|BM097048 EBpi07_SQ002_D20_R pistil, 12 DPA, no treatment, cv Optic, EBpi07
Hordeum vulgare subsp. vulgare cDNA clone
EBpi07_SQ002_D20 5', mRNA sequence
Length = 554
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 409 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 468
Query: 585 ctcacg 590
||||||
Sbjct: 469 ctcacg 474
>gb|BM370467.2|BM370467 EBro08_SQ004_F03_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ004_F03 5', mRNA sequence
Length = 677
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 409 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 468
Query: 585 ctcacg 590
||||||
Sbjct: 469 ctcacg 474
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 569 tcagcggcggcggcaacgacttctccgccttc 600
>gb|BQ764714.1|BQ764714 EBca01_SQ004_N14_R carpel, pre-anthesis, no treatment, cv Optic,
EBca01 Hordeum vulgare subsp. vulgare cDNA clone
EBca01_SQ004_N14 5', mRNA sequence
Length = 694
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 413 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 472
Query: 585 ctcacg 590
||||||
Sbjct: 473 ctcacg 478
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 573 tcagcggcggcggcaacgacttctccgccttc 604
>gb|BQ764738.1|BQ764738 EBca01_SQ004_C20_R carpel, pre-anthesis, no treatment, cv Optic,
EBca01 Hordeum vulgare subsp. vulgare cDNA clone
EBca01_SQ004_C20 5', mRNA sequence
Length = 666
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 414 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 473
Query: 585 ctcacg 590
||||||
Sbjct: 474 ctcacg 479
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 574 tcagcggcggcggcaacgacttctccgccttc 605
>gb|BQ766448.1|BQ766448 EBro08_SQ006_G04_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ006_G04 5', mRNA sequence
Length = 595
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 413 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 472
Query: 585 ctcacg 590
||||||
Sbjct: 473 ctcacg 478
>gb|BQ766550.1|BQ766550 EBro08_SQ006_M08_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ006_M08 5', mRNA sequence
Length = 656
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 373 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 432
Query: 585 ctcacg 590
||||||
Sbjct: 433 ctcacg 438
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 533 tcagcggcggcggcaacgacttctccgccttc 564
>gb|BU978796.1|BU978796 HA14E18r HA Hordeum vulgare subsp. vulgare cDNA clone HA14E18
5-PRIME, mRNA sequence
Length = 322
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 159 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 218
Query: 585 ctcacg 590
||||||
Sbjct: 219 ctcacg 224
>gb|BU998577.1|BU998577 HI11H24r HI Hordeum vulgare subsp. vulgare cDNA clone HI11H24
5-PRIME, mRNA sequence
Length = 639
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 364 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 423
Query: 585 ctcacg 590
||||||
Sbjct: 424 ctcacg 429
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 524 tcagcggcggcggcaacgacttctccgccttc 555
>gb|CA018242.1|CA018242 HV08A20r HV Hordeum vulgare subsp. vulgare cDNA clone HV08A20
5-PRIME, mRNA sequence
Length = 607
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 204 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 263
Query: 585 ctcacg 590
||||||
Sbjct: 264 ctcacg 269
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 364 tcagcggcggcggcaacgacttctccgccttc 395
>gb|CA019961.1|CA019961 HV13O21r HV Hordeum vulgare subsp. vulgare cDNA clone HV13O21
5-PRIME, mRNA sequence
Length = 502
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 414 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 473
Query: 585 ctcacg 590
||||||
Sbjct: 474 ctcacg 479
>gb|CA020452.1|CA020452 HZ36F18r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ36F18
5-PRIME, mRNA sequence
Length = 576
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 397 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 456
Query: 585 ctcacg 590
||||||
Sbjct: 457 ctcacg 462
>gb|CA020490.1|CA020490 HZ36H14r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ36H14
5-PRIME, mRNA sequence
Length = 575
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 396 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 455
Query: 585 ctcacg 590
||||||
Sbjct: 456 ctcacg 461
>gb|CA020504.1|CA020504 HZ36I05r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ36I05
5-PRIME, mRNA sequence
Length = 626
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 268 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 327
Query: 585 ctcacg 590
||||||
Sbjct: 328 ctcacg 333
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 428 tcagcggcggcggcaacgacttctccgccttc 459
>gb|CA020509.1|CA020509 HZ36I10r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ36I10
5-PRIME, mRNA sequence
Length = 609
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 325 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 384
Query: 585 ctcacg 590
||||||
Sbjct: 385 ctcacg 390
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 485 tcagcggcggcggcaacgacttctccgccttc 516
>gb|CA020797.1|CA020797 HZ37L23r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ37L23
5-PRIME, mRNA sequence
Length = 488
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 325 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 384
Query: 585 ctcacg 590
||||||
Sbjct: 385 ctcacg 390
>gb|CA021207.1|CA021207 HZ39G22r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ39G22
5-PRIME, mRNA sequence
Length = 568
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 407 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 466
Query: 585 ctcacg 590
||||||
Sbjct: 467 ctcacg 472
>gb|CA021345.1|CA021345 HZ39N05r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ39N05
5-PRIME, mRNA sequence
Length = 580
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 398 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 457
Query: 585 ctcacg 590
||||||
Sbjct: 458 ctcacg 463
>gb|CA021424.1|CA021424 HZ40B03r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ40B03
5-PRIME, mRNA sequence
Length = 466
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 151 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 210
Query: 585 ctcacg 590
||||||
Sbjct: 211 ctcacg 216
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 688 tcagcgccggcggcaatgacttctccgccttc 719
|||||| ||||||||| |||||||||||||||
Sbjct: 311 tcagcggcggcggcaacgacttctccgccttc 342
>gb|CA022132.1|CA022132 HZ42E03r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ42E03
5-PRIME, mRNA sequence
Length = 589
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 407 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 466
Query: 585 ctcacg 590
||||||
Sbjct: 467 ctcacg 472
>gb|CA022223.1|CA022223 HZ42I04r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ42I04
5-PRIME, mRNA sequence
Length = 562
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 398 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 457
Query: 585 ctcacg 590
||||||
Sbjct: 458 ctcacg 463
>gb|CA022589.1|CA022589 HZ43L15r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ43L15
5-PRIME, mRNA sequence
Length = 476
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 407 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 466
Query: 585 ctcacg 590
||||||
Sbjct: 467 ctcacg 472
>gb|CA022592.1|CA022592 HZ43L18r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ43L18
5-PRIME, mRNA sequence
Length = 474
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 407 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 466
Query: 585 ctcacg 590
||||||
Sbjct: 467 ctcacg 472
>gb|CA022610.1|CA022610 HZ43N05r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ43N05
5-PRIME, mRNA sequence
Length = 479
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 391 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 450
Query: 585 ctcacg 590
||||||
Sbjct: 451 ctcacg 456
>gb|CA022683.1|CA022683 HZ44B01r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ44B01
5-PRIME, mRNA sequence
Length = 556
Score = 60.0 bits (30), Expect = 2e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 525 attggtgccaattacgcgtctggtggatctggcattctcaacaccacgggaaacgggaca 584
||||| ||||| ||||| || |||||||| ||||| ||| ||||||||||||| |||||
Sbjct: 395 attggcgccaactacgcttccggtggatccggcatcctcgacaccacgggaaaagggacg 454
Query: 585 ctcacg 590
||||||
Sbjct: 455 ctcacg 460
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 157,063
Number of Sequences: 312970
Number of extensions: 157063
Number of successful extensions: 44695
Number of sequences better than 0.5: 140
Number of HSP's better than 0.5 without gapping: 139
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 44393
Number of HSP's gapped (non-prelim): 303
length of query: 1520
length of database: 175,134,539
effective HSP length: 19
effective length of query: 1501
effective length of database: 169,188,109
effective search space: 253951351609
effective search space used: 253951351609
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)