BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2823202.2.1
(529 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|AJ311603.1|HVU311603 Hordeum vulgare mRNA for putative ... 139 1e-031
gb|AV920399.1|AV920399 AV920399 K. Sato unpublished cDNA li... 125 2e-027
gb|BQ665439.1|BQ665439 HX03J22u HX Hordeum vulgare subsp. v... 125 2e-027
gb|CB876328.1|CB876328 HX10P08w HX Hordeum vulgare subsp. v... 125 2e-027
gb|AJ434759.1|AJ434759 AJ434759 S00002 Hordeum vulgare subs... 107 4e-022
gb|BG369725.1|BG369725 HVSMEi0025K22f Hordeum vulgare 20 DA... 101 2e-020
gb|BF257877.2|BF257877 HVSMEf0014B21f Hordeum vulgare seedl... 92 2e-017
gb|BM372230.2|BM372230 EBro03_SQ004_G04_R root, 3 week, wat... 74 5e-012
gb|BM816691.1|BM816691 HB01E06_T3.ab1 HB Hordeum vulgare su... 72 2e-011
gb|CB883084.1|CB883084 HQ01C10w HQ Hordeum vulgare subsp. v... 64 5e-009
dbj|D83178.1| Hordeum vulgare mRNA for endonuclease, comple... 64 5e-009
gb|BQ760826.1|BQ760826 EBro03_SQ003_J11_R root, 3 week, wat... 58 3e-007
gb|BM372422.2|BM372422 EBro03_SQ004_O15_R root, 3 week, wat... 50 7e-005
gb|BQ766149.1|BQ766149 EBro08_SQ005_M06_R root, 3 week, dro... 44 0.005
gb|BM816925.1|BM816925 HC113E05_SK.ab1 HC Hordeum vulgare s... 38 0.28
>emb|AJ311603.1|HVU311603 Hordeum vulgare mRNA for putative nuclease (bnuc2 gene)
Length = 1139
Score = 139 bits (70), Expect = 1e-031
Identities = 202/246 (82%)
Strand = Plus / Plus
Query: 8 ggccatccagcagaacatcacggaggagtgggctgatgaggagaagaagtgggaggcctg 67
||||||||||| |||||||| ||||| ||| | ||||||||| |||||||||| ||
Sbjct: 649 ggccatccagcgtaacatcaccgaggactggtccagcgaggagaagcagtgggaggcgtg 708
Query: 68 ccgtagccggacaaagacctgtgctgacaagtacgctgcagagagcgcgaagctggcctg 127
||| ||| | || |||||||| |||||||||||||||| ||||| || |||||||||
Sbjct: 709 ccgcagcagaaccaagacctgcgctgacaagtacgctgaggagagtgcagtgctggcctg 768
Query: 128 cacggcgtacgagggtgtcgaccaagactccaccttggaagatgactacttcttcgccgc 187
| |||||| |||| ||| | || ||||||||||| | |||||| |||| |||| ||
Sbjct: 769 cgacgcgtacaagggcgtcaagcaggactccaccttaggagatgagtactacttcaaggc 828
Query: 188 gctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaa 247
||||||||| ||||||||| ||||||| || || |||||||||||||| |||||||||||
Sbjct: 829 gctgccggtcgttcagaagcggatcgctcagggcggcgtcaggctggcggcgatcctcaa 888
Query: 248 caggat 253
| ||||
Sbjct: 889 ccggat 894
>gb|AV920399.1|AV920399 AV920399 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags13m18 3', mRNA sequence
Length = 663
Score = 125 bits (63), Expect = 2e-027
Identities = 141/167 (84%)
Strand = Plus / Minus
Query: 87 tgtgctgacaagtacgctgcagagagcgcgaagctggcctgcacggcgtacgagggtgtc 146
||||||||||||||||| | ||||||||| ||||| | ||| | ||||||| ||| |
Sbjct: 482 tgtgctgacaagtacgcggaggagagcgcggagctgtcgtgccccgcgtacgtgggcgct 423
Query: 147 gaccaagactccaccttggaagatgactacttcttcgccgcgctgccggtggttcagaag 206
||||| | ||||| ||| |||||||| ||||||||| ||||||||||| |||||||||
Sbjct: 422 gaccatggctccaacttagaagatgagtacttcttcaaagcgctgccggtcgttcagaag 363
Query: 207 aggatcgcgcaagggggcgtcaggctggccgcgatcctcaacaggat 253
|||||||| || || |||||||||||||| |||||||||||| ||||
Sbjct: 362 aggatcgctcagggtggcgtcaggctggcggcgatcctcaaccggat 316
>gb|BQ665439.1|BQ665439 HX03J22u HX Hordeum vulgare subsp. vulgare cDNA clone HX03J22
3-PRIME, mRNA sequence
Length = 428
Score = 125 bits (63), Expect = 2e-027
Identities = 141/167 (84%)
Strand = Plus / Minus
Query: 87 tgtgctgacaagtacgctgcagagagcgcgaagctggcctgcacggcgtacgagggtgtc 146
||||||||||||||||| | ||||||||| ||||| | ||| | ||||||| ||| |
Sbjct: 405 tgtgctgacaagtacgcggaggagagcgcggagctgtcgtgccccgcgtacgtgggcgct 346
Query: 147 gaccaagactccaccttggaagatgactacttcttcgccgcgctgccggtggttcagaag 206
||||| | ||||| ||| |||||||| ||||||||| ||||||||||| |||||||||
Sbjct: 345 gaccatggctccaacttagaagatgagtacttcttcaaagcgctgccggtcgttcagaag 286
Query: 207 aggatcgcgcaagggggcgtcaggctggccgcgatcctcaacaggat 253
|||||||| || || |||||||||||||| |||||||||||| ||||
Sbjct: 285 aggatcgctcagggtggcgtcaggctggcggcgatcctcaaccggat 239
>gb|CB876328.1|CB876328 HX10P08w HX Hordeum vulgare subsp. vulgare cDNA clone HX10P08
3-PRIME, mRNA sequence
Length = 597
Score = 125 bits (63), Expect = 2e-027
Identities = 141/167 (84%)
Strand = Plus / Minus
Query: 87 tgtgctgacaagtacgctgcagagagcgcgaagctggcctgcacggcgtacgagggtgtc 146
||||||||||||||||| | ||||||||| ||||| | ||| | ||||||| ||| |
Sbjct: 423 tgtgctgacaagtacgcggaggagagcgcggagctgtcgtgccccgcgtacgtgggcgct 364
Query: 147 gaccaagactccaccttggaagatgactacttcttcgccgcgctgccggtggttcagaag 206
||||| | ||||| ||| |||||||| ||||||||| ||||||||||| |||||||||
Sbjct: 363 gaccatggctccaacttagaagatgagtacttcttcaaagcgctgccggtcgttcagaag 304
Query: 207 aggatcgcgcaagggggcgtcaggctggccgcgatcctcaacaggat 253
|||||||| || || |||||||||||||| |||||||||||| ||||
Sbjct: 303 aggatcgctcagggtggcgtcaggctggcggcgatcctcaaccggat 257
>gb|AJ434759.1|AJ434759 AJ434759 S00002 Hordeum vulgare subsp. vulgare cDNA clone
S0000200006A08F1, mRNA sequence
Length = 502
Score = 107 bits (54), Expect = 4e-022
Identities = 171/210 (81%)
Strand = Plus / Plus
Query: 44 tgaggagaagaagtgggaggcctgccgtagccggacaaagacctgtgctgacaagtacgc 103
|||||||||| |||||||||| ||||| ||| || | |||||| ||||| ||||||||
Sbjct: 89 tgaggagaagcagtgggaggcgtgccgcagcaaaaccacgacctgcgctgagaagtacgc 148
Query: 104 tgcagagagcgcgaagctggcctgcacggcgtacgagggtgtcgaccaagactccacctt 163
||||||||| |||||| ||| ||||||||||| ||||| || ||| |||| |
Sbjct: 149 ccaggagagcgcggtgctggcatgcgacgcgtacgagggcgtcgagcaggacgacaccct 208
Query: 164 ggaagatgactacttcttcgccgcgctgccggtggttcagaagaggatcgcgcaaggggg 223
| |||||| |||| |||| ||||||||||| |||||||||||| |||| || |||||
Sbjct: 209 aggagatgagtactacttcaaggcgctgccggtcgttcagaagaggctcgctcagggggg 268
Query: 224 cgtcaggctggccgcgatcctcaacaggat 253
||| |||||||| |||||||||||||||||
Sbjct: 269 cgtgaggctggcggcgatcctcaacaggat 298
>gb|BG369725.1|BG369725 HVSMEi0025K22f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0025K22f, mRNA sequence
Length = 698
Score = 101 bits (51), Expect = 2e-020
Identities = 78/87 (89%)
Strand = Plus / Plus
Query: 167 agatgactacttcttcgccgcgctgccggtggttcagaagaggatcgcgcaagggggcgt 226
|||||| ||||||||| ||||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 467 agatgagtacttcttcaaagcgctgccggtcgttcagaagaggatcgctcaaggtggcgt 526
Query: 227 caggctggccgcgatcctcaacaggat 253
||||||||| |||||||||||| ||||
Sbjct: 527 caggctggcggcgatcctcaaccggat 553
>gb|BF257877.2|BF257877 HVSMEf0014B21f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0014B21f, mRNA sequence
Length = 572
Score = 91.7 bits (46), Expect = 2e-017
Identities = 169/210 (80%)
Strand = Plus / Plus
Query: 44 tgaggagaagaagtgggaggcctgccgtagccggacaaagacctgtgctgacaagtacgc 103
|||||||||| |||||||||| ||||| | | || | |||||| ||||| ||||||||
Sbjct: 319 tgaggagaagcagtgggaggcgtgccgcatcataaccacgacctgcgctgagaagtacgc 378
Query: 104 tgcagagagcgcgaagctggcctgcacggcgtacgagggtgtcgaccaagactccacctt 163
||||||||| |||||| ||| ||||||||||| ||||| || ||| |||| |
Sbjct: 379 ccaggagagcgcggtgctggcatgcgacgcgtacgagggcgtcgagcaggacgacaccct 438
Query: 164 ggaagatgactacttcttcgccgcgctgccggtggttcagaagaggatcgcgcaaggggg 223
| |||||| |||| |||| ||||||||||| ||||||| |||| |||| || |||||
Sbjct: 439 aggagatgagtactacttcaaggcgctgccggtcgttcagatgaggctcgctcagggggg 498
Query: 224 cgtcaggctggccgcgatcctcaacaggat 253
||| |||||||| |||||||||||||||||
Sbjct: 499 cgtgaggctggcggcgatcctcaacaggat 528
>gb|BM372230.2|BM372230 EBro03_SQ004_G04_R root, 3 week, waterlogged, cv Optic, EBro03
Hordeum vulgare subsp. vulgare cDNA clone
EBro03_SQ004_G04 5', mRNA sequence
Length = 526
Score = 73.8 bits (37), Expect = 5e-012
Identities = 60/68 (88%)
Strand = Plus / Plus
Query: 186 gcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctc 245
||||||||||| |||||||||||| |||| || |||||||| |||||||| || ||||||
Sbjct: 191 gcgctgccggtcgttcagaagaggctcgcccangggggcgtgaggctggcggccatcctc 250
Query: 246 aacaggat 253
||| ||||
Sbjct: 251 aaccggat 258
>gb|BM816691.1|BM816691 HB01E06_T3.ab1 HB Hordeum vulgare subsp. vulgare cDNA clone
HB01E06_T3.ab1 similar to ESTs
D48949(S15541),AU097625(S15541) correspond to a region
of the predicted gene. Similar to Arabidopsis thaliana
chromosome I BAC T22E19; putative bifunctional nuclease
(AC016447) [Oryza sativa], mRNA sequence
Length = 837
Score = 71.9 bits (36), Expect = 2e-011
Identities = 60/68 (88%)
Strand = Plus / Plus
Query: 186 gcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctc 245
||||||||||| |||||||||||| |||| || |||||||| |||||||| || ||||||
Sbjct: 525 gcgctgccggtcgttcagaagaggctcgcccaggggggcgtgaggctggcggccatcctc 584
Query: 246 aacaggat 253
||| ||||
Sbjct: 585 aaccggat 592
>gb|CB883084.1|CB883084 HQ01C10w HQ Hordeum vulgare subsp. vulgare cDNA clone HQ01C10
3-PRIME, mRNA sequence
Length = 684
Score = 63.9 bits (32), Expect = 5e-009
Identities = 59/68 (86%)
Strand = Plus / Minus
Query: 186 gcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctc 245
||||||||||| |||||||||||||| || || || ||||| |||||||| || ||||||
Sbjct: 537 gcgctgccggtcgttcagaagaggattgcccagggaggcgtgaggctggcggccatcctc 478
Query: 246 aacaggat 253
||| ||||
Sbjct: 477 aaccggat 470
>dbj|D83178.1| Hordeum vulgare mRNA for endonuclease, complete cds
Length = 1180
Score = 63.9 bits (32), Expect = 5e-009
Identities = 59/68 (86%)
Strand = Plus / Plus
Query: 186 gcgctgccggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctc 245
||||||||||| |||||||||||| |||| || |||||| | |||||||| || ||||||
Sbjct: 820 gcgctgccggtcgttcagaagaggctcgcccaggggggcttgaggctggcggccatcctc 879
Query: 246 aacaggat 253
||| ||||
Sbjct: 880 aaccggat 887
>gb|BQ760826.1|BQ760826 EBro03_SQ003_J11_R root, 3 week, waterlogged, cv Optic, EBro03
Hordeum vulgare subsp. vulgare cDNA clone
EBro03_SQ003_J11 5', mRNA sequence
Length = 341
Score = 58.0 bits (29), Expect = 3e-007
Identities = 53/61 (86%)
Strand = Plus / Plus
Query: 193 cggtggttcagaagaggatcgcgcaagggggcgtcaggctggccgcgatcctcaacagga 252
|||| |||||||||||| |||| || |||||||| |||||||| || ||||||||| |||
Sbjct: 1 cggtcgttcagaagaggctcgcccaggggggcgtgaggctggcggccatcctcaaccgga 60
Query: 253 t 253
|
Sbjct: 61 t 61
>gb|BM372422.2|BM372422 EBro03_SQ004_O15_R root, 3 week, waterlogged, cv Optic, EBro03
Hordeum vulgare subsp. vulgare cDNA clone
EBro03_SQ004_O15 5', mRNA sequence
Length = 565
Score = 50.1 bits (25), Expect = 7e-005
Identities = 60/69 (86%), Gaps = 2/69 (2%)
Strand = Plus / Plus
Query: 186 gcgctgccggtggttcagaaga-ggatcgcgcaagggggcgtcaggctggccgcgatcct 244
||||||||||| |||||||||| || |||| | ||||||||| |||||||| || |||||
Sbjct: 286 gcgctgccggtcgttcagaagagggctcgc-ccagggggcgtgaggctggcggccatcct 344
Query: 245 caacaggat 253
|||| ||||
Sbjct: 345 caaccggat 353
>gb|BQ766149.1|BQ766149 EBro08_SQ005_M06_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ005_M06 5', mRNA sequence
Length = 687
Score = 44.1 bits (22), Expect = 0.005
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 38 ggctgatgaggagaagaagtgggagg 63
||||||||||||||||||| ||||||
Sbjct: 116 ggctgatgaggagaagaagagggagg 141
>gb|BM816925.1|BM816925 HC113E05_SK.ab1 HC Hordeum vulgare subsp. vulgare cDNA clone
HC113E05_SK.ab1 similar to
Alpha-amylase,Glycoprotein-fucosylgalactoside
alpha-galactosyltransferase, mRNA sequence
Length = 920
Score = 38.2 bits (19), Expect = 0.28
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 41 tgatgaggagaagaagtgg 59
|||||||||||||||||||
Sbjct: 501 tgatgaggagaagaagtgg 519
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 56,258
Number of Sequences: 312970
Number of extensions: 56258
Number of successful extensions: 17472
Number of sequences better than 0.5: 15
Number of HSP's better than 0.5 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17455
Number of HSP's gapped (non-prelim): 16
length of query: 529
length of database: 175,134,539
effective HSP length: 19
effective length of query: 510
effective length of database: 169,188,109
effective search space: 86285935590
effective search space used: 86285935590
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)