BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2762970.2.1
(578 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV925468.1|AV925468 AV925468 K. Sato unpublished cDNA li... 236 7e-061
gb|U46003.1|HVU46003 Hordeum vulgare beta-D-glucan exohydro... 236 7e-061
gb|BF257182.2|BF257182 HVSMEf0012B20f Hordeum vulgare seedl... 208 1e-052
gb|AV913362.1|AV913362 AV913362 K. Sato unpublished cDNA li... 180 3e-044
gb|AV918661.1|AV918661 AV918661 K. Sato unpublished cDNA li... 180 3e-044
gb|AV914506.1|AV914506 AV914506 K. Sato unpublished cDNA li... 178 1e-043
gb|AV919570.1|AV919570 AV919570 K. Sato unpublished cDNA li... 174 2e-042
gb|BU977331.1|BU977331 HA11D20r HA Hordeum vulgare subsp. v... 170 3e-041
gb|AV920100.1|AV920100 AV920100 K. Sato unpublished cDNA li... 165 2e-039
gb|AV911128.1|AV911128 AV911128 K. Sato unpublished cDNA li... 161 3e-038
gb|AL504655.1|AL504655 AL504655 Hordeum vulgare Barke roots... 159 1e-037
gb|AV909243.1|AV909243 AV909243 K. Sato unpublished cDNA li... 151 3e-035
gb|AV930613.1|AV930613 AV930613 K. Sato unpublished cDNA li... 151 3e-035
gb|BQ765660.1|BQ765660 EBro03_SQ007_F19_R root, 3 week, wat... 151 3e-035
gb|BF627275.3|BF627275 HVSMEb0004G19f Hordeum vulgare seedl... 149 1e-034
gb|BI947544.1|BI947544 HVSMEl0005N11f Hordeum vulgare spike... 143 7e-033
gb|BQ761635.1|BQ761635 EBem10_SQ001_J09_R embryo, 2 Day ger... 133 7e-030
gb|BQ663930.1|BQ663930 HU04K15u HU Hordeum vulgare subsp. v... 131 3e-029
gb|BM374002.2|BM374002 EBma03_SQ003_F17_R maternal, 8 DPA, ... 131 3e-029
gb|BM098018.2|BM098018 EBpi03_SQ002_F03_R pistil, 4 DPA, no... 131 3e-029
gb|BU997464.1|BU997464 HI08B05r HI Hordeum vulgare subsp. v... 131 3e-029
gb|BJ467252.1|BJ467252 BJ467252 K. Sato unpublished cDNA li... 131 3e-029
gb|CB858339.1|CB858339 HI06K15w HI Hordeum vulgare subsp. v... 131 3e-029
gb|BE411093.1|BE411093 ISC002.C07F990406 ITEC ISC Barley Le... 117 4e-025
gb|CA032659.1|CA032659 HX13N01r HX Hordeum vulgare subsp. v... 117 4e-025
gb|AL503553.1|AL503553 AL503553 Hordeum vulgare Barke roots... 103 6e-021
gb|BU983489.1|BU983489 HA29O13r HA Hordeum vulgare subsp. v... 92 2e-017
gb|CA019039.1|CA019039 HV10I20r HV Hordeum vulgare subsp. v... 88 4e-016
gb|AV917377.1|AV917377 AV917377 K. Sato unpublished cDNA li... 78 4e-013
gb|BQ657885.1|BQ657885 HA06J20u HA Hordeum vulgare subsp. v... 74 6e-012
gb|BI951410.1|BI951410 HVSMEl0025N13f Hordeum vulgare spike... 72 2e-011
gb|BQ469930.1|BQ469930 HX01E12T HX Hordeum vulgare subsp. v... 72 2e-011
gb|BM100567.2|BM100567 EBma01_SQ005_J17_R maternal, 4 DPA, ... 72 2e-011
gb|BU996476.1|BU996476 HM13L18r HM Hordeum vulgare subsp. v... 72 2e-011
gb|CA022582.1|CA022582 HZ43L07r HZ Hordeum vulgare subsp. v... 72 2e-011
gb|CA026644.1|CA026644 HZ56I06r HZ Hordeum vulgare subsp. v... 72 2e-011
gb|AF102868.1| Hordeum vulgare subsp. vulgare beta-D-glucan... 72 2e-011
gb|BQ462668.1|BQ462668 HI01K09T HI Hordeum vulgare subsp. v... 70 9e-011
gb|BQ464740.1|BQ464740 HU01E02T HU Hordeum vulgare subsp. v... 70 9e-011
gb|BQ662134.1|BQ662134 HR01L02u HR Hordeum vulgare subsp. v... 70 9e-011
gb|BU976239.1|BU976239 HA03G04u HA Hordeum vulgare subsp. v... 70 9e-011
gb|CA020043.1|CA020043 HV14C18r HV Hordeum vulgare subsp. v... 70 9e-011
gb|AL502756.1|AL502756 AL502756 Hordeum vulgare Barke roots... 66 1e-009
gb|AL510704.1|AL510704 AL510704 Hordeum vulgare Barke devel... 66 1e-009
gb|BI956426.1|BI956426 HVSMEn0003E13f Hordeum vulgare rachi... 66 1e-009
gb|BM101478.2|BM101478 EBpi01_SQ003_P14_R pistil, 1 DPA, no... 66 1e-009
gb|BU977332.1|BU977332 HA11D20u HA Hordeum vulgare subsp. v... 66 1e-009
gb|CA023517.1|CA023517 HZ46H20r HZ Hordeum vulgare subsp. v... 66 1e-009
gb|CA019151.1|CA019151 HV10P13r HV Hordeum vulgare subsp. v... 64 5e-009
gb|BI956324.1|BI956324 HVSMEn0002G07f Hordeum vulgare rachi... 62 2e-008
gb|BQ462564.1|BQ462564 HI01E18T HI Hordeum vulgare subsp. v... 62 2e-008
gb|BQ468807.1|BQ468807 HM02G11r HM Hordeum vulgare subsp. v... 62 2e-008
gb|CB881387.1|CB881387 HM09K13w HM Hordeum vulgare subsp. v... 62 2e-008
gb|BG416639.1|BG416639 HVSMEk0013O04f Hordeum vulgare testa... 60 8e-008
gb|AL508845.1|AL508845 AL508845 Hordeum vulgare Barke devel... 58 3e-007
gb|BM376573.1|BM376573 EBem05_SQ002_J19_R embryo, 14 DPA, n... 56 1e-006
gb|BQ458498.1|BQ458498 HA05A21r HA Hordeum vulgare subsp. v... 56 1e-006
gb|BQ465777.1|BQ465777 HU04K15r HU Hordeum vulgare subsp. v... 56 1e-006
gb|BU977300.1|BU977300 HA11D01r HA Hordeum vulgare subsp. v... 56 1e-006
gb|BM374213.2|BM374213 EBma03_SQ003_P16_R maternal, 8 DPA, ... 54 5e-006
gb|BM098044.2|BM098044 EBpi03_SQ002_G06_R pistil, 4 DPA, no... 54 5e-006
gb|BU973151.1|BU973151 HB23O18r BC Hordeum vulgare subsp. v... 54 5e-006
gb|BU996833.1|BU996833 HM14O21r HM Hordeum vulgare subsp. v... 54 5e-006
gb|CA015249.1|CA015249 HT13L19r HT Hordeum vulgare subsp. v... 54 5e-006
gb|CA028903.1|CA028903 HZ63J10r HZ Hordeum vulgare subsp. v... 54 5e-006
gb|BQ468423.1|BQ468423 HM01D10T HM Hordeum vulgare subsp. v... 52 2e-005
gb|BU995937.1|BU995937 HM11N11r HM Hordeum vulgare subsp. v... 50 8e-005
gb|CB882092.1|CB882092 HM11N11w HM Hordeum vulgare subsp. v... 50 8e-005
gb|BG366042.2|BG366042 HVSMEi0004P02f Hordeum vulgare 20 DA... 48 3e-004
gb|BQ468024.1|BQ468024 HR01L02r HR Hordeum vulgare subsp. v... 48 3e-004
gb|BU976238.1|BU976238 HA03G04r HA Hordeum vulgare subsp. v... 48 3e-004
gb|BI958825.1|BI958825 HVSMEn0016M12f Hordeum vulgare rachi... 44 0.005
gb|BF255596.2|BF255596 HVSMEf0007E15f Hordeum vulgare seedl... 42 0.020
gb|BI955986.1|BI955986 HVSMEm0025E17f Hordeum vulgare green... 38 0.31
gb|BG418718.1|BG418718 HVSMEk0024C10f Hordeum vulgare testa... 38 0.31
gb|BQ661201.1|BQ661201 HM02G11u HM Hordeum vulgare subsp. v... 38 0.31
gb|CD662373.1|CD662373 UCRHV18_01dg12_b1 Drought-stressed D... 38 0.31
gb|CD663198.1|CD663198 UCRHV18_04cg09_b1 Drought-stressed D... 38 0.31
gb|CK122487.1|CK122487 BES1824103k16 BES1824 Hordeum vulgar... 38 0.31
>gb|AV925468.1|AV925468 AV925468 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd24f16 5', mRNA sequence
Length = 621
Score = 236 bits (119), Expect = 7e-061
Identities = 410/504 (81%), Gaps = 6/504 (1%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||||||| |||| || ||||||||||| || | || ||||||||||||||
Sbjct: 91 ccccatgagcagaatcaacgatgctgtctacaggattctcagggtgaagttcaccatggg 150
Query: 61 cctgttcgagaacccttaccccgactctagcctcgccggcgagctcgggaagcaagaaca 120
|| || |||| ||| || | ||| | ||||||| || || ||||||||||| |||||
Sbjct: 151 tctatttgagagcccctatgctgacccaagcctcgttggtgaactcgggaagcaggaaca 210
Query: 121 ccgggaactggcgcgcgaagccgtcaggaaatccctggttctcctgaagaacggcaagtc 180
||| || || || || || ||||||||||| || |||| | ||||| || || || ||
Sbjct: 211 ccgcgatcttgctcgtgaggccgtcaggaagtcattggtgttgctgaaaaatggaaaatc 270
Query: 181 ctcctacgctccgttgctgcccctcccgaagaaggccggcaagatcctggtcgccggcag 240
||| | |||| ||| |||| ||||| ||||||||||| |||||||| ||||| || ||
Sbjct: 271 tgcctccactccattgttgcctctcccaaagaaggccggtaagatcctcgtcgctggaag 330
Query: 241 ccacgccaacgacctgggcaaccagtgcggggggtggacgatcacgtggcaaggaagcag 300
|||||| ||||| |||||||||||||||| || ||||| ||||| ||||||||| |
Sbjct: 331 ccacgctgacgacttgggcaaccagtgcggaggatggaccatcacatggcaaggacagac 390
Query: 301 cggcaac---actactgccggcacgacgatcctctccgggatcgaggccaccgtggaccc 357
||||||| | |||||||| ||||||||||| || | |||| || ||||||| |||||
Sbjct: 391 cggcaacgacaaaactgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccc 450
Query: 358 cagcacgcaggtggtgtactcggagagcccggacagcggcgt-gctggc--cgacaagta 414
||||||| ||||||| | ||| |||| ||| ||||||| || | || | || ||||||
Sbjct: 451 cagcacggaggtggtcttctcagagaaccctgacagcgccgccgttgacagcggcaagta 510
Query: 415 cgactacgcgatcgtggtggtcggggagccgccatacgcggagacgttcggcgacaacct 474
||||||||| |||||||||||||| ||||| || ||||| ||||||||||||||||||||
Sbjct: 511 cgactacgccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcgacaacct 570
Query: 475 gaacctgacgatcccggcgcccgg 498
||||||||||||||| ||||||||
Sbjct: 571 gaacctgacgatccctgcgcccgg 594
>gb|U46003.1|HVU46003 Hordeum vulgare beta-D-glucan exohydrolase, isoenzyme ExoII, mRNA,
complete cds
Length = 2105
Score = 236 bits (119), Expect = 7e-061
Identities = 410/504 (81%), Gaps = 6/504 (1%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||||||| |||| || ||||||||||| || | || ||||||||||||||
Sbjct: 1099 ccccatgagcagaatcaacgatgctgtctacaggattctcagggtgaagttcaccatggg 1158
Query: 61 cctgttcgagaacccttaccccgactctagcctcgccggcgagctcgggaagcaagaaca 120
|| || |||| ||| || | ||| | ||||||| || || ||||||||||| |||||
Sbjct: 1159 tctatttgagagcccctatgctgacccaagcctcgttggtgaactcgggaagcaggaaca 1218
Query: 121 ccgggaactggcgcgcgaagccgtcaggaaatccctggttctcctgaagaacggcaagtc 180
||| || || || || || ||||||||||| || |||| | ||||| || || || ||
Sbjct: 1219 ccgtgatcttgctcgtgaggccgtcaggaagtcattggtgttgctgaaaaatggaaaatc 1278
Query: 181 ctcctacgctccgttgctgcccctcccgaagaaggccggcaagatcctggtcgccggcag 240
||| | |||| ||| |||| ||||| ||||||||||| |||||||| ||||| || ||
Sbjct: 1279 tgcctccactccattgttgcctctcccaaagaaggccggtaagatcctcgtcgctggaag 1338
Query: 241 ccacgccaacgacctgggcaaccagtgcggggggtggacgatcacgtggcaaggaagcag 300
||||||| ||||| |||||||||||||||| || ||||| ||||| ||||||||| |
Sbjct: 1339 ccacgccgacgacttgggcaaccagtgcggaggatggaccatcacatggcaaggacagac 1398
Query: 301 cggcaac---actactgccggcacgacgatcctctccgggatcgaggccaccgtggaccc 357
||||||| | |||||||| ||||||||||| || | |||| || ||||||| |||||
Sbjct: 1399 cggcaacgacaaaactgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccc 1458
Query: 358 cagcacgcaggtggtgtactcggagagcccggacagcggcgt-gctggc--cgacaagta 414
||||||| ||||||| | ||| |||| || ||||||| || | || | || ||||||
Sbjct: 1459 cagcacggaggtggtcttctcagagaatcctgacagcgccgccgttgacagcggcaagta 1518
Query: 415 cgactacgcgatcgtggtggtcggggagccgccatacgcggagacgttcggcgacaacct 474
||||||||| |||||||||||||| ||||| || ||||| ||||||||||||||||||||
Sbjct: 1519 cgactacgccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcgacaacct 1578
Query: 475 gaacctgacgatcccggcgcccgg 498
||||||||||||||| ||||||||
Sbjct: 1579 gaacctgacgatccctgcgcccgg 1602
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 1639 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 1682
>gb|BF257182.2|BF257182 HVSMEf0012B20f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0012B20f, mRNA sequence
Length = 537
Score = 208 bits (105), Expect = 1e-052
Identities = 393/486 (80%), Gaps = 6/486 (1%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||||||| |||| || ||||||||||| || | || ||||||||||||||
Sbjct: 52 ccccatgagcagaatcaacgatgctgtctacaggattctcagggtgaagttcaccatggg 111
Query: 61 cctgttcgagaacccttaccccgactctagcctcgccggcgagctcgggaagcaagaaca 120
|| || |||| ||| || | ||| | |||||| || || ||||||||||| |||||
Sbjct: 112 tctatttgagagcccctatgctgacccaagcctcattggtgaactcgggaagcaggaaca 171
Query: 121 ccgggaactggcgcgcgaagccgtcaggaaatccctggttctcctgaagaacggcaagtc 180
||| || || || || || ||||||||||| || |||| | ||||| || || || ||
Sbjct: 172 ccgtgatcttgctcgtgaggccgtcaggaagtcattggtgttgctgaaaaatggaaaatc 231
Query: 181 ctcctacgctccgttgctgcccctcccgaagaaggccggcaagatcctggtcgccggcag 240
||| | |||| ||| |||| ||||| ||||||||||| |||||||| ||||| || ||
Sbjct: 232 tgcctccactccattgttgcctctcccaaagaaggccggtaagatcctcgtcgctggaag 291
Query: 241 ccacgccaacgacctgggcaaccagtgcggggggtggacgatcacgtggcaaggaagcag 300
||||||| ||||| |||||||||||||||| || ||||| ||||| ||||||||| |
Sbjct: 292 ccacgccgacgacttgggcaaccagtgcggaggatggaccatcacatggcaaggacagac 351
Query: 301 cggcaac---actactgccggcacgacgatcctctccgggatcgaggccaccgtggaccc 357
||||||| | |||||||| ||||||||||| || | |||| || ||||||| |||||
Sbjct: 352 cggcaacgacaaaactgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccc 411
Query: 358 cagcacgcaggtggtgtactcggagagcccggacagcggcgt-gctggc--cgacaagta 414
||||||| ||||||| | ||| |||| ||| ||||||| || | || | || ||||||
Sbjct: 412 cagcacggaggtggtcttctcagagaaccctgacagcgccgccgttgacagcggcaagta 471
Query: 415 cgactacgcgatcgtggtggtcggggagccgccatacgcggagacgttcggcgacaacct 474
||||||||| |||||||||||||| ||||| || ||||| ||||||||||||||||||||
Sbjct: 472 cgactacgccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcgacaacct 531
Query: 475 gaacct 480
||||||
Sbjct: 532 gaacct 537
>gb|AV913362.1|AV913362 AV913362 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21m18 5', mRNA sequence
Length = 585
Score = 180 bits (91), Expect = 3e-044
Identities = 238/284 (83%), Gaps = 6/284 (2%)
Strand = Plus / Plus
Query: 221 aagatcctggtcgccggcagccacgccaacgacctgggcaaccagtgcggggggtggacg 280
|||||||| ||||| || |||||||| ||||| |||||||||||||||| || |||||
Sbjct: 16 aagatcctcgtcgctggaagccacgctgacgacttgggcaaccagtgcggaggatggacc 75
Query: 281 atcacgtggcaaggaagcagcggcaac---actactgccggcacgacgatcctctccggg 337
||||| ||||||||| | ||||||| | |||||||| ||||||||||| || | |
Sbjct: 76 atcacatggcaaggacagaccggcaacgacaaaactgccgggacgacgatcctttcggcg 135
Query: 338 atcgaggccaccgtggaccccagcacgcaggtggtgtactcggagagcccggacagcggc 397
||| || ||||||| |||||||||||| ||||||| | ||| |||| ||| ||||||| |
Sbjct: 136 atcaagtccaccgtcgaccccagcacggaggtggtcttctcagagaaccctgacagcgcc 195
Query: 398 gt-gctggc--cgacaagtacgactacgcgatcgtggtggtcggggagccgccatacgcg 454
| | || | || ||||||||||||||| |||||||||||||| ||||| || |||||
Sbjct: 196 gccgttgacagcggcaagtacgactacgccatcgtggtggtcggcgagccaccgtacgct 255
Query: 455 gagacgttcggcgacaacctgaacctgacgatcccggcgcccgg 498
||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 256 gagacgttcggcgacaacctgaacctgacgatccctgcgcccgg 299
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 336 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 379
>gb|AV918661.1|AV918661 AV918661 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21m18 3', mRNA sequence
Length = 663
Score = 180 bits (91), Expect = 3e-044
Identities = 238/284 (83%), Gaps = 6/284 (2%)
Strand = Plus / Minus
Query: 221 aagatcctggtcgccggcagccacgccaacgacctgggcaaccagtgcggggggtggacg 280
|||||||| ||||| || |||||||| ||||| |||||||||||||||| || |||||
Sbjct: 660 aagatcctcgtcgctggaagccacgctgacgacttgggcaaccagtgcggaggatggacc 601
Query: 281 atcacgtggcaaggaagcagcggcaac---actactgccggcacgacgatcctctccggg 337
||||| ||||||||| | ||||||| | |||||||| ||||||||||| || | |
Sbjct: 600 atcacatggcaaggacagaccggcaacgacaaaactgccgggacgacgatcctttcggcg 541
Query: 338 atcgaggccaccgtggaccccagcacgcaggtggtgtactcggagagcccggacagcggc 397
||| || ||||||| |||||||||||| ||||||| | ||| |||| ||| ||||||| |
Sbjct: 540 atcaagtccaccgtcgaccccagcacggaggtggtcttctcagagaaccctgacagcgcc 481
Query: 398 gt-gctggc--cgacaagtacgactacgcgatcgtggtggtcggggagccgccatacgcg 454
| | || | || ||||||||||||||| |||||||||||||| ||||| || |||||
Sbjct: 480 gccgttgacagcggcaagtacgactacgccatcgtggtggtcggcgagccaccgtacgct 421
Query: 455 gagacgttcggcgacaacctgaacctgacgatcccggcgcccgg 498
||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 420 gagacgttcggcgacaacctgaacctgacgatccctgcgcccgg 377
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 340 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 297
>gb|AV914506.1|AV914506 AV914506 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags6k08 5', mRNA sequence
Length = 544
Score = 178 bits (90), Expect = 1e-043
Identities = 262/316 (82%), Gaps = 6/316 (1%)
Strand = Plus / Plus
Query: 189 ctccgttgctgcccctcccgaagaaggccggcaagatcctggtcgccggcagccacgcca 248
|||| ||| |||| ||||| ||||||||||| |||||||| ||||| || ||||||||
Sbjct: 111 ctccattgttgcctctcccaaagaaggccggtaagatcctcgtcgctggaagccacgctg 170
Query: 249 acgacctgggcaaccagtgcggggggtggacgatcacgtggcaaggaagcagcggcaac- 307
|| || |||||||||||||||| || ||||| ||||| ||| ||| | |||||||
Sbjct: 171 acnacttgggcaaccagtgcggaggatggaccatcacatggnngggacagaccggcaacg 230
Query: 308 acta--ctgccggcacgacgatcctctccgggatcgaggccaccgtggaccccagcacgc 365
|| | ||||||| ||||||||||| || | |||| || ||||||| ||||||||||||
Sbjct: 231 acnaaactgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccccagcacgg 290
Query: 366 aggtggtgtactcggagagcccggacagcggcgt-gctggc--cgacaagtacgactacg 422
||||||| | ||| |||| ||| ||||||| || | || | || ||||||||||||||
Sbjct: 291 aggtggtcttctcagagaaccctgacagcgccgccgttgacagcggcaagtacgactacg 350
Query: 423 cgatcgtggtggtcggggagccgccatacgcggagacgttcggcgacaacctgaacctga 482
| |||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||||
Sbjct: 351 ccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcgacaacctgaacctga 410
Query: 483 cgatcccggcgcccgg 498
||||||| ||||||||
Sbjct: 411 cgatccctgcgcccgg 426
>gb|AV919570.1|AV919570 AV919570 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags6k08 3', mRNA sequence
Length = 696
Score = 174 bits (88), Expect = 2e-042
Identities = 244/292 (83%), Gaps = 8/292 (2%)
Strand = Plus / Minus
Query: 215 gccggcaagatcctggtcgccggcagccacgcc-aacgacctgggcaaccagtgcggggg 273
||||| |||||||| ||||| || |||||||| |||||| |||||||||||||||| ||
Sbjct: 696 gccggtaagatcctcgtcgctggaagccacgctgaacgacttgggcaaccagtgcggagg 637
Query: 274 gtggacgatcacgtggcaaggaagcagcggcaac----actactgccggcacgacgatcc 329
||||| ||||| ||||||||| | ||||||| | |||||||| ||||||||||
Sbjct: 636 atggaccatcacatggcaaggacagaccggcaacgacaaaaactgccgggacgacgatcc 577
Query: 330 tctccgggatcgaggccaccgtggaccccagcacgcaggtggtgtactcggagagcccgg 389
| || | |||| || ||||||| |||||||||||| ||||||| | ||| |||| ||| |
Sbjct: 576 tttcggcgatcaagtccaccgtcgaccccagcacggaggtggtcttctcagagaaccctg 517
Query: 390 acagcggcgt-gctggc--cgacaagtacgactacgcgatcgtggtggtcggggagccgc 446
|||||| || | || | || ||||||||||||||| |||||||||||||| ||||| |
Sbjct: 516 acagcgccgccgttgacagcggcaagtacgactacgccatcgtggtggtcggcgagccac 457
Query: 447 catacgcggagacgttcggcgacaacctgaacctgacgatcccggcgcccgg 498
| ||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 456 cgtacgctgagacgttcggcgacaacctgaacctgacgatccctgcgcccgg 405
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 368 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 325
>gb|BU977331.1|BU977331 HA11D20r HA Hordeum vulgare subsp. vulgare cDNA clone HA11D20
5-PRIME, mRNA sequence
Length = 486
Score = 170 bits (86), Expect = 3e-041
Identities = 368/459 (80%), Gaps = 6/459 (1%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||||||| |||| || ||||||||||| || | || ||||||||||||||
Sbjct: 28 ccccatgagcagaatcaacgatgctgtctacaggattctcagggtgaagttcaccatggg 87
Query: 61 cctgttcgagaacccttaccccgactctagcctcgccggcgagctcgggaagcaagaaca 120
|| || |||| ||| || | ||| | ||||||| || || ||||||||||| |||||
Sbjct: 88 tctatttgagagcccctatgctgacccaagcctcgttggtgaactcgggaagcaggaaca 147
Query: 121 ccgggaactggcgcgcgaagccgtcaggaaatccctggttctcctgaagaacggcaagtc 180
||| || || || || || ||||||||||| || |||| | ||||| || || || ||
Sbjct: 148 ccgtgatcttgctcgtgaggccgtcaggaagtcattggtgttgctgaaaaatggaaaatc 207
Query: 181 ctcctacgctccgttgctgcccctcccgaagaaggccggcaagatcctggtcgccggcag 240
||| | |||| ||| |||| ||||| ||||||||||| |||||||| ||||| || ||
Sbjct: 208 tgcctccactccattgttgcctctcccaaagaaggccggtaagatcctcgtcgctggaag 267
Query: 241 ccacgccaacgacctgggcaaccagtgcggggggtggacgatcacgtggcaaggaagcag 300
||||||| ||||| |||||||||||||||| || ||||| ||||| ||||||||| |
Sbjct: 268 ccacgccgacgacttgggcaaccagtgcggaggatggaccatcacatggcaaggacagac 327
Query: 301 cggca---acactactgccggcacgacgatcctctccgggatcgaggccaccgtggaccc 357
||||| ||| |||||||| ||||||||||| || | |||| || ||||||| |||||
Sbjct: 328 cggcaacgacaaaactgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccc 387
Query: 358 cagcacgcaggtggtgtactcggagagcccggacagcggcg-tgctggc--cgacaagta 414
||||||| ||||||| | ||| |||| ||| ||||||| || | || | || ||||||
Sbjct: 388 cagcacggaggtggtcttctcagagaaccctgacagcgccgccgttgacagcggcaagta 447
Query: 415 cgactacgcgatcgtggtggtcggggagccgccatacgc 453
||||||||| |||||||||||||| ||||| || |||||
Sbjct: 448 cgactacgccatcgtggtggtcggcgagccaccgtacgc 486
>gb|AV920100.1|AV920100 AV920100 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags9e08 3', mRNA sequence
Length = 682
Score = 165 bits (83), Expect = 2e-039
Identities = 215/256 (83%), Gaps = 6/256 (2%)
Strand = Plus / Minus
Query: 249 acgacctgggcaaccagtgcggggggtggacgatcacgtggcaaggaagcagcggcaac- 307
||||| |||||||||||||||| || ||||| ||||| ||||||||| | |||||||
Sbjct: 660 acgacttgggcaaccagtgcggaggatggaccatcacatggcaaggacagaccggcaacg 601
Query: 308 --actactgccggcacgacgatcctctccgggatcgaggccaccgtggaccccagcacgc 365
| |||||||| ||||||||||| || | |||| || ||||||| ||||||||||||
Sbjct: 600 acaaaactgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccccagcacgg 541
Query: 366 aggtggtgtactcggagagcccggacagcggcgt-gctggc--cgacaagtacgactacg 422
||||||| | ||| |||| ||| ||||||| || | || | || ||||||||||||||
Sbjct: 540 aggtggtcttctcagagaaccctgacagcgccgccgttgacagcggcaagtacgactacg 481
Query: 423 cgatcgtggtggtcggggagccgccatacgcggagacgttcggcgacaacctgaacctga 482
| |||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||||
Sbjct: 480 ccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcgacaacctgaacctga 421
Query: 483 cgatcccggcgcccgg 498
||||||| ||||||||
Sbjct: 420 cgatccctgcgcccgg 405
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 368 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 325
>gb|AV911128.1|AV911128 AV911128 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak12b24 3', mRNA sequence
Length = 609
Score = 161 bits (81), Expect = 3e-038
Identities = 224/271 (82%), Gaps = 3/271 (1%)
Strand = Plus / Minus
Query: 311 actgccggcacgacgatcctctccgggatcgaggccaccgtggaccccagcacgcaggtg 370
|||||||| ||||||||||| || | |||| || ||||||| |||||||||||| |||||
Sbjct: 598 actgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccccagcacggaggtg 539
Query: 371 gtgtactcggagagcccggacagcggcgt-gctggc--cgacaagtacgactacgcgatc 427
|| | ||| |||| ||| ||||||| || | || | || ||||||||||||||| |||
Sbjct: 538 gtcttctcagagaaccctgacagcgccgccgttgacagcggcaagtacgactacgccatc 479
Query: 428 gtggtggtcggggagccgccatacgcggagacgttcggcgacaacctgaacctgacgatc 487
||||||||||| ||||| || ||||| |||||||||||||||||||||||||||||||||
Sbjct: 478 gtggtggtcggcgagccaccgtacgccgagacgttcggcgacaacctgaacctgacgatc 419
Query: 488 ccggcgcccgggccgagcgtnanccagtcggtgtgcgganncgccaagtgcgttgtggtc 547
|| |||||||| || || | |||| | |||||| || || |||||| |||||
Sbjct: 418 cctgcgcccggcccctcggtgatccagaccgtgtgcaagagcgtcaggtgcgtggtggtg 359
Query: 548 ctcatctccggcaggcngctggtggtggagc 578
|||||||||||||||| ||||||| ||||||
Sbjct: 358 ctcatctccggcaggccgctggtgctggagc 328
>gb|AL504655.1|AL504655 AL504655 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW05P08V 5', mRNA sequence
Length = 700
Score = 159 bits (80), Expect = 1e-037
Identities = 319/398 (80%), Gaps = 3/398 (0%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||||||| |||| || ||||||||||| || | || ||||||||||||||
Sbjct: 181 ccccatgagcagaatcaacgatgctgtctacaggattctcagggtgaagttcaccatggg 240
Query: 61 cctgttcgagaacccttaccccgactctagcctcgccggcgagctcgggaagcaagaaca 120
|| || |||| ||| || | ||| | ||||||| || || ||||||||||| |||||
Sbjct: 241 tctatttgagagcccctatgctgacccaagcctcgttggtgaactcgggaagcaggaaca 300
Query: 121 ccgggaactggcgcgcgaagccgtcaggaaatccctggttctcctgaagaacggcaagtc 180
||| || || || || || ||||||||||| || |||| | ||||| || || || ||
Sbjct: 301 ccgtgatcttgctcgtgaggccgtcaggaagtcattggtgttgctgaaaaatggaaaatc 360
Query: 181 ctcctacgctccgttgctgcccctcccgaagaaggccggcaagatcctggtcgccggcag 240
||| | |||| ||| |||| ||||| ||||||||||| |||||||| ||||| || ||
Sbjct: 361 tgcctccactccattgttgcctctcccaaagaaggccggtaagatcctcgtcgctggaag 420
Query: 241 ccacgccaacgacctgggcaaccagtgcggggggtggacgatcacgtggcaaggaagcag 300
||||||| ||||| |||||||||||||||| || ||||| ||||| ||||||||| |
Sbjct: 421 ccacgccgacgacttgggcaaccagtgcggaggatggaccatcacatggcaaggacagac 480
Query: 301 cggca---acactactgccggcacgacgatcctctccgggatcgaggccaccgtggaccc 357
||||| ||| |||||||| ||||||||||| || | |||| || ||||||| |||||
Sbjct: 481 cggcaacgacaaaactgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccc 540
Query: 358 cagcacgcaggtggtgtactcggagagcccggacagcg 395
||||||| ||||||| | ||| |||| ||| |||||||
Sbjct: 541 cagcacggaggtggtcttctcagagaaccctgacagcg 578
Score = 109 bits (55), Expect = 1e-022
Identities = 70/75 (93%)
Strand = Plus / Plus
Query: 415 cgactacgcgatcgtggtggtcggggagccgccatacgcggagacgttcggcgacaacct 474
||||||||| |||||||||||||| ||||| || ||||| ||||||||||||||||||||
Sbjct: 603 cgactacgccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcgacaacct 662
Query: 475 gaacctgacgatccc 489
|||||||||||||||
Sbjct: 663 gaacctgacgatccc 677
>gb|AV909243.1|AV909243 AV909243 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak12b24 5', mRNA sequence
Length = 655
Score = 151 bits (76), Expect = 3e-035
Identities = 216/262 (82%), Gaps = 3/262 (1%)
Strand = Plus / Plus
Query: 320 acgacgatcctctccgggatcgaggccaccgtggaccccagcacgcaggtggtgtactcg 379
||||||||||| || | |||| || ||||||| |||||||||||| ||||||| | |||
Sbjct: 46 acgacgatcctttcggcgatcaagtccaccgtcgaccccagcacggaggtggtcttctca 105
Query: 380 gagagcccggacagcggcgt-gctggc--cgacaagtacgactacgcgatcgtggtggtc 436
|||| ||| ||||||| || | || | || ||||||||||||||| ||||||||||||
Sbjct: 106 gagaaccctgacagcgccgccgttgacagcggcaagtacgactacgccatcgtggtggtc 165
Query: 437 ggggagccgccatacgcggagacgttcggcgacaacctgaacctgacgatcccggcgccc 496
|| ||||| || ||||| ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 166 ggcgagccaccgtacgccgagacgttcggcgacaacctgaacctgacgatccctgcgccc 225
Query: 497 gggccgagcgtnanccagtcggtgtgcgganncgccaagtgcgttgtggtcctcatctcc 556
|| || || | |||| | |||||| || || |||||| ||||| |||||||||
Sbjct: 226 ggcccctcggtgatccagaccgtgtgcaagagcgtcaggtgcgtggtggtgctcatctcc 285
Query: 557 ggcaggcngctggtggtggagc 578
||||||| ||||||| ||||||
Sbjct: 286 ggcaggccgctggtgctggagc 307
>gb|AV930613.1|AV930613 AV930613 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd24f16 3', mRNA sequence
Length = 599
Score = 151 bits (76), Expect = 3e-035
Identities = 164/191 (85%), Gaps = 3/191 (1%)
Strand = Plus / Minus
Query: 311 actgccggcacgacgatcctctccgggatcgaggccaccgtggaccccagcacgcaggtg 370
|||||||| ||||||||||| || | |||| || ||||||| |||||||||||| |||||
Sbjct: 560 actgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccccagcacggaggtg 501
Query: 371 gtgtactcggagagcccggacagcggcgt-gctggc--cgacaagtacgactacgcgatc 427
|| | ||| |||| ||| ||||||| || | || | || ||||||||||||||| |||
Sbjct: 500 gtcttctcagagaaccctgacagcgccgccgttgacagcggcaagtacgactacgccatc 441
Query: 428 gtggtggtcggggagccgccatacgcggagacgttcggcgacaacctgaacctgacgatc 487
||||||||||| ||||| || ||||| |||||||||||||||||||||||||||||||||
Sbjct: 440 gtggtggtcggcgagccaccgtacgctgagacgttcggcgacaacctgaacctgacgatc 381
Query: 488 ccggcgcccgg 498
|| ||||||||
Sbjct: 380 cctgcgcccgg 370
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 333 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 290
>gb|BQ765660.1|BQ765660 EBro03_SQ007_F19_R root, 3 week, waterlogged, cv Optic, EBro03
Hordeum vulgare subsp. vulgare cDNA clone
EBro03_SQ007_F19 5', mRNA sequence
Length = 371
Score = 151 bits (76), Expect = 3e-035
Identities = 164/191 (85%), Gaps = 3/191 (1%)
Strand = Plus / Plus
Query: 311 actgccggcacgacgatcctctccgggatcgaggccaccgtggaccccagcacgcaggtg 370
|||||||| ||||||||||| || | |||| || ||||||| |||||||||||| |||||
Sbjct: 15 actgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccccagcacggaggtg 74
Query: 371 gtgtactcggagagcccggacagcggcgt-gctggc--cgacaagtacgactacgcgatc 427
|| | ||| |||| ||| ||||||| || | || | || ||||||||||||||| |||
Sbjct: 75 gtcttctcagagaaccctgacagcgccgccgttgacagcggcaagtacgactacgccatc 134
Query: 428 gtggtggtcggggagccgccatacgcggagacgttcggcgacaacctgaacctgacgatc 487
||||||||||| ||||| || ||||| |||||||||||||||||||||||||||||||||
Sbjct: 135 gtggtggtcggcgagccaccgtacgctgagacgttcggcgacaacctgaacctgacgatc 194
Query: 488 ccggcgcccgg 498
|| ||||||||
Sbjct: 195 cctgcgcccgg 205
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 242 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 285
>gb|BF627275.3|BF627275 HVSMEb0004G19f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0004G19f, mRNA sequence
Length = 636
Score = 149 bits (75), Expect = 1e-034
Identities = 163/190 (85%), Gaps = 3/190 (1%)
Strand = Plus / Plus
Query: 312 ctgccggcacgacgatcctctccgggatcgaggccaccgtggaccccagcacgcaggtgg 371
||||||| ||||||||||| || | |||| || ||||||| |||||||||||| ||||||
Sbjct: 7 ctgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccccagcacggaggtgg 66
Query: 372 tgtactcggagagcccggacagcggcgt-gctggc--cgacaagtacgactacgcgatcg 428
| | ||| |||| ||| ||||||| || | || | || ||||||||||||||| ||||
Sbjct: 67 tcttctcagagaaccctgacagcgccgccgttgacagcggcaagtacgactacgccatcg 126
Query: 429 tggtggtcggggagccgccatacgcggagacgttcggcgacaacctgaacctgacgatcc 488
|||||||||| ||||| || ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 127 tggtggtcggcgagccaccgtacgctgagacgttcggcgacaacctgaacctgacgatcc 186
Query: 489 cggcgcccgg 498
| ||||||||
Sbjct: 187 ctgcgcccgg 196
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 233 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 276
>gb|BI947544.1|BI947544 HVSMEl0005N11f Hordeum vulgare spike EST library HVcDNA0012
(Fusarium infected) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEl0005N11f, mRNA sequence
Length = 489
Score = 143 bits (72), Expect = 7e-033
Identities = 259/317 (81%), Gaps = 7/317 (2%)
Strand = Plus / Plus
Query: 189 ctccgttgctgcccctcccgaagaaggccggcaagatcctggtcgccggcagccacgcca 248
|||| ||| |||| ||||| ||||||||||| |||||||| ||||| || |||||||||
Sbjct: 55 ctccattgttgcctctcccaaagaaggccggtaagatcctcgtcgctggaagccacgccg 114
Query: 249 acgacctgggcaaccagtgcggggggtggacgatcacgtggcaaggaagcagcggca--- 305
||||| |||||||||||||||| || ||||| ||||| ||||||||| | |||||
Sbjct: 115 acgacttgggcaaccagtgcggaggatggaccatcacatggcaaggacagaccggcaacg 174
Query: 306 acactactgccggcacgacgatcctctccgggatcgaggccaccgtggaccccagcacgc 365
||| |||||||| ||||||||||| || | |||| || ||||||| ||||||||||||
Sbjct: 175 acaaaactgccgggacgacgatcctttcggcgatcaagtccaccgtcgaccccagcacgg 234
Query: 366 aggtggtgtactcggagagcccggacagcggcg-tgctggc--cgacaagtacgactacg 422
||||||| | ||| |||| ||| ||||||| || | || | || ||||||||||||||
Sbjct: 235 aggtggtcttctcagagaaccctgacagcgccgccgttgacagcggcaagtacgactacg 294
Query: 423 cgatcgtggtggtcggggagccgccatacgcggagacgttc-ggcgacaacctgaacctg 481
| |||||||||||||| ||||| || || | | || ||| ||| ||||||||||||||
Sbjct: 295 ccatcgtggtggtcggcgagccacccgacccttaaaccttcgggcaacaacctgaacctg 354
Query: 482 acgatcccggcgcccgg 498
||||| || ||||||||
Sbjct: 355 acgattcctgcgcccgg 371
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 532 caagtgcgttgtggtcctcatctccggcaggcngctggtggtgg 575
||||||||| ||||| |||||||||||||||| |||||||||||
Sbjct: 405 caagtgcgtggtggtgctcatctccggcaggccgctggtggtgg 448
>gb|BQ761635.1|BQ761635 EBem10_SQ001_J09_R embryo, 2 Day germination, no treatment, cv
Optic, EBem10 Hordeum vulgare subsp. vulgare cDNA clone
EBem10_SQ001_J09 5', mRNA sequence
Length = 255
Score = 133 bits (67), Expect = 7e-030
Identities = 152/178 (85%), Gaps = 3/178 (1%)
Strand = Plus / Plus
Query: 324 cgatcctctccgggatcgaggccaccgtggaccccagcacgcaggtggtgtactcggaga 383
||||||| || | |||| || ||||||| |||||||||||| ||||||| | ||| ||||
Sbjct: 1 cgatcctttcggcgatcaagtccaccgtcgaccccagcacggaggtggtcttctcagaga 60
Query: 384 gcccggacagcggcgt-gctggc--cgacaagtacgactacgcgatcgtggtggtcgggg 440
||| ||||||| || | || | || ||||||||||||||| |||||||||||||| |
Sbjct: 61 accctgacagcgccgccgttgacagcggcaagtacgactacgccatcgtggtggtcggcg 120
Query: 441 agccgccatacgcggagacgttcggcgacaacctgaacctgacgatcccggcgcccgg 498
|||| || ||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 121 agccaccgtacgctgagacgttcggcgacaacctgaacctgacgatccctgcgcccgg 178
Score = 60.0 bits (30), Expect = 8e-008
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtgg 575
|||||| ||||| |||||||||||||||| |||||||||||
Sbjct: 215 gtgcgtggtggtgctcatctccggcaggccgctggtggtgg 255
>gb|BQ663930.1|BQ663930 HU04K15u HU Hordeum vulgare subsp. vulgare cDNA clone HU04K15
3-PRIME, mRNA sequence
Length = 582
Score = 131 bits (66), Expect = 3e-029
Identities = 84/90 (93%)
Strand = Plus / Minus
Query: 409 caagtacgactacgcgatcgtggtggtcggggagccgccatacgcggagacgttcggcga 468
||||||||||||||| |||||||||||||| ||||| || ||||| ||||||||||||||
Sbjct: 508 caagtacgactacgccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcga 449
Query: 469 caacctgaacctgacgatcccggcgcccgg 498
||||||||||||||||||||| ||||||||
Sbjct: 448 caacctgaacctgacgatccctgcgcccgg 419
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 382 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 339
>gb|BM374002.2|BM374002 EBma03_SQ003_F17_R maternal, 8 DPA, no treatment, cv Optic, EBma03
Hordeum vulgare subsp. vulgare cDNA clone
EBma03_SQ003_F17 5', mRNA sequence
Length = 533
Score = 131 bits (66), Expect = 3e-029
Identities = 84/90 (93%)
Strand = Plus / Plus
Query: 409 caagtacgactacgcgatcgtggtggtcggggagccgccatacgcggagacgttcggcga 468
||||||||||||||| |||||||||||||| ||||| || ||||| ||||||||||||||
Sbjct: 16 caagtacgactacgccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcga 75
Query: 469 caacctgaacctgacgatcccggcgcccgg 498
||||||||||||||||||||| ||||||||
Sbjct: 76 caacctgaacctgacgatccctgcgcccgg 105
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 142 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 185
>gb|BM098018.2|BM098018 EBpi03_SQ002_F03_R pistil, 4 DPA, no treatment, cv Optic, EBpi03
Hordeum vulgare subsp. vulgare cDNA clone
EBpi03_SQ002_F03 5', mRNA sequence
Length = 523
Score = 131 bits (66), Expect = 3e-029
Identities = 84/90 (93%)
Strand = Plus / Plus
Query: 409 caagtacgactacgcgatcgtggtggtcggggagccgccatacgcggagacgttcggcga 468
||||||||||||||| |||||||||||||| ||||| || ||||| ||||||||||||||
Sbjct: 17 caagtacgactacgccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcga 76
Query: 469 caacctgaacctgacgatcccggcgcccgg 498
||||||||||||||||||||| ||||||||
Sbjct: 77 caacctgaacctgacgatccctgcgcccgg 106
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 143 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 186
>gb|BU997464.1|BU997464 HI08B05r HI Hordeum vulgare subsp. vulgare cDNA clone HI08B05
5-PRIME, mRNA sequence
Length = 594
Score = 131 bits (66), Expect = 3e-029
Identities = 84/90 (93%)
Strand = Plus / Minus
Query: 409 caagtacgactacgcgatcgtggtggtcggggagccgccatacgcggagacgttcggcga 468
||||||||||||||| |||||||||||||| ||||| || ||||| ||||||||||||||
Sbjct: 532 caagtacgactacgccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcga 473
Query: 469 caacctgaacctgacgatcccggcgcccgg 498
||||||||||||||||||||| ||||||||
Sbjct: 472 caacctgaacctgacgatccctgcgcccgg 443
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 406 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 363
>gb|BJ467252.1|BJ467252 BJ467252 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags26e21 3', mRNA sequence
Length = 522
Score = 131 bits (66), Expect = 3e-029
Identities = 84/90 (93%)
Strand = Plus / Minus
Query: 409 caagtacgactacgcgatcgtggtggtcggggagccgccatacgcggagacgttcggcga 468
||||||||||||||| |||||||||||||| ||||| || ||||| ||||||||||||||
Sbjct: 488 caagtacgactacgccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcga 429
Query: 469 caacctgaacctgacgatcccggcgcccgg 498
||||||||||||||||||||| ||||||||
Sbjct: 428 caacctgaacctgacgatccctgcgcccgg 399
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 362 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 319
>gb|CB858339.1|CB858339 HI06K15w HI Hordeum vulgare subsp. vulgare cDNA clone HI06K15
3-PRIME, mRNA sequence
Length = 542
Score = 131 bits (66), Expect = 3e-029
Identities = 84/90 (93%)
Strand = Plus / Minus
Query: 409 caagtacgactacgcgatcgtggtggtcggggagccgccatacgcggagacgttcggcga 468
||||||||||||||| |||||||||||||| ||||| || ||||| ||||||||||||||
Sbjct: 508 caagtacgactacgccatcgtggtggtcggcgagccaccgtacgctgagacgttcggcga 449
Query: 469 caacctgaacctgacgatcccggcgcccgg 498
||||||||||||||||||||| ||||||||
Sbjct: 448 caacctgaacctgacgatccctgcgcccgg 419
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 382 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 339
>gb|BE411093.1|BE411093 ISC002.C07F990406 ITEC ISC Barley Leaf Library Hordeum vulgare
subsp. vulgare cDNA clone ISC002.C07, mRNA sequence
Length = 426
Score = 117 bits (59), Expect = 4e-025
Identities = 230/287 (80%)
Strand = Plus / Plus
Query: 9 gcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatgggcctgttcg 68
|||||||| |||| || ||||||||||| || | || |||||||||||||| || || |
Sbjct: 1 gcagaatcaacgatgctgtctacaggattctcagggtgaagttcaccatgggtctatttg 60
Query: 69 agaacccttaccccgactctagcctcgccggcgagctcgggaagcaagaacaccgggaac 128
||| ||| || | ||| | ||||||| || || ||||||||||| |||||||| || |
Sbjct: 61 agagcccctatgctgacccaagcctcgttggtgaactcgggaagcaggaacaccgtgatc 120
Query: 129 tggcgcgcgaagccgtcaggaaatccctggttctcctgaagaacggcaagtcctcctacg 188
| || || || ||||||||||| || |||| | ||||| || || || || ||| |
Sbjct: 121 ttgctcgtgaggccgtcaggaagtcattggtgttgctgaaaaatggaaaatctgcctcca 180
Query: 189 ctccgttgctgcccctcccgaagaaggccggcaagatcctggtcgccggcagccacgcca 248
|||| ||| |||| ||||| ||||||||||| |||||||| ||||| || |||||||||
Sbjct: 181 ctccattgttgcctctcccaaagaaggccggtaagatcctcgtcgctggaagccacgccg 240
Query: 249 acgacctgggcaaccagtgcggggggtggacgatcacgtggcaagga 295
||||| |||||||||||||||| || ||||| ||||| |||||||||
Sbjct: 241 acgacttgggcaaccagtgcggaggatggaccatcacatggcaagga 287
>gb|CA032659.1|CA032659 HX13N01r HX Hordeum vulgare subsp. vulgare cDNA clone HX13N01
5-PRIME, mRNA sequence
Length = 326
Score = 117 bits (59), Expect = 4e-025
Identities = 170/207 (82%)
Strand = Plus / Plus
Query: 89 agcctcgccggcgagctcgggaagcaagaacaccgggaactggcgcgcgaagccgtcagg 148
|||||||| || || ||||||||||| |||||||| || || || || || |||||||||
Sbjct: 55 agcctcgctggtgaactcgggaagcaggaacaccgtgatcttgctcgtgaggccgtcagg 114
Query: 149 aaatccctggttctcctgaagaacggcaagtcctcctacgctccgttgctgcccctcccg 208
|| || |||| | ||||| || || || || ||||| |||| ||| |||| |||||
Sbjct: 115 aagtcattggtgttgctgaaaaatggaaaatctgcctacactccattgttgcctctccca 174
Query: 209 aagaaggccggcaagatcctggtcgccggcagccacgccaacgacctgggcaaccagtgc 268
||||||||||| |||||||| ||||| || ||||||||| ||||| ||||||||||||||
Sbjct: 175 aagaaggccggtaagatcctcgtcgctggaagccacgccgacgacttgggcaaccagtgc 234
Query: 269 ggggggtggacgatcacgtggcaagga 295
|| || ||||| ||||| |||||||||
Sbjct: 235 ggaggatggaccatcacatggcaagga 261
>gb|AL503553.1|AL503553 AL503553 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW02J07T 5', mRNA sequence
Length = 700
Score = 103 bits (52), Expect = 6e-021
Identities = 218/272 (80%), Gaps = 1/272 (0%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||||||| |||| || ||||||||||| || | || ||||||||||||||
Sbjct: 383 ccccatgagcagaatcaacgatgctgtctacaggattctcagggtgaagttcaccatggg 442
Query: 61 cctgttcgagaacccttaccccgactctagcctcgccggcgagctcgggaagcaagaaca 120
|| || |||| ||| || | ||| | ||||||| || || ||||||||||| |||||
Sbjct: 443 tctatttgagagcccctatgctgacccaagcctcgttggtgaactcgggaagcaggaaca 502
Query: 121 ccgggaactggcgcgcgaagccgtcaggaaatccctggttctcctgaagaacggcaagtc 180
||| || || || || || ||||||||||| || |||| | ||||| || || || ||
Sbjct: 503 ccgtgatcttgctcgtgaggccgtcaggaagtcattggtgttgctgaaaaatggaaaatc 562
Query: 181 ctcctacgctccgttgctgcccctcccgaagaaggccggcaag-atcctggtcgccggca 239
||| | |||| ||| |||| ||||| ||||||||||| ||| ||||| ||||| || |
Sbjct: 563 tgcctccactccattgttgcctctcccaaagaaggccggtaaggatcctcgtcgctggaa 622
Query: 240 gccacgccaacgacctgggcaaccagtgcggg 271
|||||||| ||||| |||||||||||||||||
Sbjct: 623 gccacgccgacgacttgggcaaccagtgcggg 654
>gb|BU983489.1|BU983489 HA29O13r HA Hordeum vulgare subsp. vulgare cDNA clone HA29O13
5-PRIME, mRNA sequence
Length = 447
Score = 91.7 bits (46), Expect = 2e-017
Identities = 61/66 (92%)
Strand = Plus / Plus
Query: 433 ggtcggggagccgccatacgcggagacgttcggcgacaacctgaacctgacgatcccggc 492
|||||| ||||| || ||||| ||||||||||||||||||||||||||||||||||| ||
Sbjct: 11 ggtcggcgagccaccgtacgctgagacgttcggcgacaacctgaacctgacgatccctgc 70
Query: 493 gcccgg 498
||||||
Sbjct: 71 gcccgg 76
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 113 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 156
>gb|CA019039.1|CA019039 HV10I20r HV Hordeum vulgare subsp. vulgare cDNA clone HV10I20
5-PRIME, mRNA sequence
Length = 485
Score = 87.7 bits (44), Expect = 4e-016
Identities = 71/80 (88%)
Strand = Plus / Plus
Query: 5 atgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatgggcctg 64
|||||||| ||||||||||||||| | ||||||| || ||||||||| |||||||||||
Sbjct: 405 atgagcaggatcgacgacgccgtcacccggatcctgcgcgtcaagttcgccatgggcctg 464
Query: 65 ttcgagaacccttaccccga 84
||||||| ||||||| ||||
Sbjct: 465 ttcgagagcccttacgccga 484
>gb|AV917377.1|AV917377 AV917377 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags18k19 5', mRNA sequence
Length = 192
Score = 77.8 bits (39), Expect = 4e-013
Identities = 135/167 (80%)
Strand = Plus / Plus
Query: 104 ctcgggaagcaagaacaccgggaactggcgcgcgaagccgtcaggaaatccctggttctc 163
||||||||||| |||||||| || || || || || ||||||||||| || |||| |
Sbjct: 22 ctcgggaagcaggaacaccgcgatcttgctcgtgaggccgtcaggaagtcattggtgttg 81
Query: 164 ctgaagaacggcaagtcctcctacgctccgttgctgcccctcccgaagaaggccggcaag 223
||||| || || || || ||| | |||| ||| |||| ||||| ||||||||||| |||
Sbjct: 82 ctgaaaaatggaaaatctgcctccactccattgttgcctctcccaaagaaggccggtaag 141
Query: 224 atcctggtcgccggcagccacgccaacgacctgggcaaccagtgcgg 270
||||| ||||| || |||||||| ||||| ||||||||||||||||
Sbjct: 142 atcctcgtcgctggaagccacgctgacgacttgggcaaccagtgcgg 188
>gb|BQ657885.1|BQ657885 HA06J20u HA Hordeum vulgare subsp. vulgare cDNA clone HA06J20
3-PRIME, mRNA sequence
Length = 454
Score = 73.8 bits (37), Expect = 6e-012
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 458 acgttcggcgacaacctgaacctgacgatcccggcgcccgg 498
|||||||||||||||||||||||||||||||| ||||||||
Sbjct: 454 acgttcggcgacaacctgaacctgacgatccctgcgcccgg 414
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 377 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 334
>gb|BI951410.1|BI951410 HVSMEl0025N13f Hordeum vulgare spike EST library HVcDNA0012
(Fusarium infected) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEl0025N13f, mRNA sequence
Length = 581
Score = 71.9 bits (36), Expect = 2e-011
Identities = 54/60 (90%)
Strand = Plus / Plus
Query: 220 caagatcctggtcgccggcagccacgccaacgacctgggcaaccagtgcggggggtggac 279
|||||||||||||||||| ||||||||| || |||||||| |||||||||| || |||||
Sbjct: 212 caagatcctggtcgccgggagccacgccgacaacctgggctaccagtgcggcggctggac 271
Score = 54.0 bits (27), Expect = 5e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 33 ggatccttcgtgtcaagttcaccatgggcctgttcgagaaccc 75
||||||| || ||||||||||||||||| || |||||||||||
Sbjct: 22 ggatcctgcgggtcaagttcaccatgggtctcttcgagaaccc 64
>gb|BQ469930.1|BQ469930 HX01E12T HX Hordeum vulgare subsp. vulgare cDNA clone HX01E12
5-PRIME, mRNA sequence
Length = 462
Score = 71.9 bits (36), Expect = 2e-011
Identities = 54/60 (90%)
Strand = Plus / Plus
Query: 220 caagatcctggtcgccggcagccacgccaacgacctgggcaaccagtgcggggggtggac 279
|||||||||||||||||| ||||||||| || |||||||| |||||||||| || |||||
Sbjct: 69 caagatcctggtcgccgggagccacgccgacaacctgggctaccagtgcggcggctggac 128
Score = 54.0 bits (27), Expect = 5e-006
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 464 ggcgacaacctgaacctgacgatcccggcgcccgg 498
|||||||||||||||||||| ||||||| ||||||
Sbjct: 316 ggcgacaacctgaacctgaccatcccggagcccgg 350
>gb|BM100567.2|BM100567 EBma01_SQ005_J17_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ005_J17 5', mRNA sequence
Length = 275
Score = 71.9 bits (36), Expect = 2e-011
Identities = 54/60 (90%)
Strand = Plus / Plus
Query: 220 caagatcctggtcgccggcagccacgccaacgacctgggcaaccagtgcggggggtggac 279
|||||||||||||||||| ||||||||| || |||||||| |||||||||| || |||||
Sbjct: 101 caagatcctggtcgccgggagccacgccgacaacctgggctaccagtgcggcggctggac 160
>gb|BU996476.1|BU996476 HM13L18r HM Hordeum vulgare subsp. vulgare cDNA clone HM13L18
5-PRIME, mRNA sequence
Length = 286
Score = 71.9 bits (36), Expect = 2e-011
Identities = 54/60 (90%)
Strand = Plus / Plus
Query: 220 caagatcctggtcgccggcagccacgccaacgacctgggcaaccagtgcggggggtggac 279
|||||||||||||||||| ||||||||| || |||||||| |||||||||| || |||||
Sbjct: 170 caagatcctggtcgccgggagccacgccgacaacctgggctaccagtgcggcggctggac 229
>gb|CA022582.1|CA022582 HZ43L07r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ43L07
5-PRIME, mRNA sequence
Length = 416
Score = 71.9 bits (36), Expect = 2e-011
Identities = 54/60 (90%)
Strand = Plus / Plus
Query: 220 caagatcctggtcgccggcagccacgccaacgacctgggcaaccagtgcggggggtggac 279
|||||||||||||||||| ||||||||| || |||||||| |||||||||| || |||||
Sbjct: 206 caagatcctggtcgccgggagccacgccgacaacctgggctaccagtgcggcggctggac 265
>gb|CA026644.1|CA026644 HZ56I06r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ56I06
5-PRIME, mRNA sequence
Length = 324
Score = 71.9 bits (36), Expect = 2e-011
Identities = 54/60 (90%)
Strand = Plus / Plus
Query: 220 caagatcctggtcgccggcagccacgccaacgacctgggcaaccagtgcggggggtggac 279
|||||||||||||||||| ||||||||| || |||||||| |||||||||| || |||||
Sbjct: 188 caagatcctggtcgccgggagccacgccgacaacctgggctaccagtgcggcggctggac 247
>gb|AF102868.1| Hordeum vulgare subsp. vulgare beta-D-glucan exohydrolase isoenzyme
ExoI mRNA, complete cds
Length = 2161
Score = 71.9 bits (36), Expect = 2e-011
Identities = 54/60 (90%)
Strand = Plus / Plus
Query: 220 caagatcctggtcgccggcagccacgccaacgacctgggcaaccagtgcggggggtggac 279
|||||||||||||||||| ||||||||| || |||||||| |||||||||| || |||||
Sbjct: 1327 caagatcctggtcgccgggagccacgccgacaacctgggctaccagtgcggcggctggac 1386
Score = 69.9 bits (35), Expect = 9e-011
Identities = 65/75 (86%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||| |||||||| ||||| | ||||||| || |||||||||||||||||
Sbjct: 1105 ccccatgagcaggatcgacgatgccgtgacccggatcctgcgggtcaagttcaccatggg 1164
Query: 61 cctgttcgagaaccc 75
|| |||||||||||
Sbjct: 1165 tctcttcgagaaccc 1179
Score = 54.0 bits (27), Expect = 5e-006
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 464 ggcgacaacctgaacctgacgatcccggcgcccgg 498
|||||||||||||||||||| ||||||| ||||||
Sbjct: 1574 ggcgacaacctgaacctgaccatcccggagcccgg 1608
>gb|BQ462668.1|BQ462668 HI01K09T HI Hordeum vulgare subsp. vulgare cDNA clone HI01K09
5-PRIME, mRNA sequence
Length = 551
Score = 69.9 bits (35), Expect = 9e-011
Identities = 65/75 (86%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||| |||||||| ||||| | ||||||| || |||||||||||||||||
Sbjct: 350 ccccatgagcaggatcgacgatgccgtgacccggatcctgcgggtcaagttcaccatggg 409
Query: 61 cctgttcgagaaccc 75
|| |||||||||||
Sbjct: 410 tctcttcgagaaccc 424
>gb|BQ464740.1|BQ464740 HU01E02T HU Hordeum vulgare subsp. vulgare cDNA clone HU01E02
5-PRIME, mRNA sequence
Length = 563
Score = 69.9 bits (35), Expect = 9e-011
Identities = 65/75 (86%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||| |||||||| ||||| | ||||||| || |||||||||||||||||
Sbjct: 345 ccccatgagcaggatcgacgatgccgtgacccggatcctgcgggtcaagttcaccatggg 404
Query: 61 cctgttcgagaaccc 75
|| |||||||||||
Sbjct: 405 tctcttcgagaaccc 419
>gb|BQ662134.1|BQ662134 HR01L02u HR Hordeum vulgare subsp. vulgare cDNA clone HR01L02
3-PRIME, mRNA sequence
Length = 457
Score = 69.9 bits (35), Expect = 9e-011
Identities = 38/39 (97%)
Strand = Plus / Minus
Query: 460 gttcggcgacaacctgaacctgacgatcccggcgcccgg 498
|||||||||||||||||||||||||||||| ||||||||
Sbjct: 457 gttcggcgacaacctgaacctgacgatccctgcgcccgg 419
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 382 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 339
>gb|BU976239.1|BU976239 HA03G04u HA Hordeum vulgare subsp. vulgare cDNA clone HA03G04
3-PRIME, mRNA sequence
Length = 456
Score = 69.9 bits (35), Expect = 9e-011
Identities = 38/39 (97%)
Strand = Plus / Minus
Query: 460 gttcggcgacaacctgaacctgacgatcccggcgcccgg 498
|||||||||||||||||||||||||||||| ||||||||
Sbjct: 456 gttcggcgacaacctgaacctgacgatccctgcgcccgg 418
Score = 61.9 bits (31), Expect = 2e-008
Identities = 39/42 (92%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtgga 576
|||||| ||||| |||||||||||||||| ||||||||||||
Sbjct: 381 gtgcgtggtggtgctcatctccggcaggccgctggtggtgga 340
>gb|CA020043.1|CA020043 HV14C18r HV Hordeum vulgare subsp. vulgare cDNA clone HV14C18
5-PRIME, mRNA sequence
Length = 542
Score = 69.9 bits (35), Expect = 9e-011
Identities = 65/75 (86%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||| |||||||| ||||| | ||||||| || |||||||||||||||||
Sbjct: 289 ccccatgagcaggatcgacgatgccgtgacccggatcctgcgggtcaagttcaccatggg 348
Query: 61 cctgttcgagaaccc 75
|| |||||||||||
Sbjct: 349 tctcttcgagaaccc 363
>gb|AL502756.1|AL502756 AL502756 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW08K03u 3', mRNA sequence
Length = 552
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 455 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 412
Score = 52.0 bits (26), Expect = 2e-005
Identities = 43/46 (93%), Gaps = 2/46 (4%)
Strand = Plus / Minus
Query: 455 gagacgttc-ggcgacaacctgaa-cctgacgatcccggcgcccgg 498
||||||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 538 gagacgttccggcgacaacctgaaacctgacgatccctgcgcccgg 493
>gb|AL510704.1|AL510704 AL510704 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY05L24u 3',
mRNA sequence
Length = 496
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 474 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 431
>gb|BI956426.1|BI956426 HVSMEn0003E13f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0003E13f, mRNA sequence
Length = 453
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 412 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 369
>gb|BM101478.2|BM101478 EBpi01_SQ003_P14_R pistil, 1 DPA, no treatment, cv Optic, EBpi01
Hordeum vulgare subsp. vulgare cDNA clone
EBpi01_SQ003_P14 5', mRNA sequence
Length = 411
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 8 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 51
>gb|BU977332.1|BU977332 HA11D20u HA Hordeum vulgare subsp. vulgare cDNA clone HA11D20
3-PRIME, mRNA sequence
Length = 439
Score = 65.9 bits (33), Expect = 1e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 535 gtgcgttgtggtcctcatctccggcaggcngctggtggtggagc 578
|||||| ||||| |||||||||||||||| ||||||||||||||
Sbjct: 382 gtgcgtggtggtgctcatctccggcaggccgctggtggtggagc 339
>gb|CA023517.1|CA023517 HZ46H20r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ46H20
5-PRIME, mRNA sequence
Length = 350
Score = 65.9 bits (33), Expect = 1e-009
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||| |||||||| ||||| | ||||||| || |||||||||||||||||
Sbjct: 226 ccccatgagcaggatcgacgatgccgtgacccggatcctgcgggtcaagttcaccatggg 285
Query: 61 cctgttcgagaaccc 75
|| || ||||||||
Sbjct: 286 tctnttngagaaccc 300
>gb|CA019151.1|CA019151 HV10P13r HV Hordeum vulgare subsp. vulgare cDNA clone HV10P13
5-PRIME, mRNA sequence
Length = 177
Score = 63.9 bits (32), Expect = 5e-009
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 224 atcctggtcgccggcagccacgccaacgacctgggcaaccagtgcggggggtggac 279
|||||||||||||| ||||||||| || |||||||| |||||||||| || |||||
Sbjct: 58 atcctggtcgccgggagccacgccgacaacctgggctaccagtgcggcggctggac 113
>gb|BI956324.1|BI956324 HVSMEn0002G07f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0002G07f, mRNA sequence
Length = 440
Score = 61.9 bits (31), Expect = 2e-008
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 1 ccccatgagcagaatcgacgacgccgtctacaggatccttcgtgtcaagttcaccatggg 60
|||||||||||| |||||||| ||||| | ||||||| || |||||||||||||||||
Sbjct: 301 ccccatgagcaggatcgacgatgccgtgacccggatcctgcgggtcaagttcaccatggg 360
Query: 61 cctgttcgagaaccc 75
|| ||| |||||||
Sbjct: 361 tctcttcaagaaccc 375
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 77,475
Number of Sequences: 312970
Number of extensions: 77475
Number of successful extensions: 24275
Number of sequences better than 0.5: 79
Number of HSP's better than 0.5 without gapping: 78
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 24069
Number of HSP's gapped (non-prelim): 197
length of query: 578
length of database: 175,134,539
effective HSP length: 19
effective length of query: 559
effective length of database: 169,188,109
effective search space: 94576152931
effective search space used: 94576152931
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)