BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2655972.2.1
(666 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU977027.1|BU977027 HA10L12r HA Hordeum vulgare subsp. v... 96 2e-018
gb|BU977028.1|BU977028 HA10L12u HA Hordeum vulgare subsp. v... 96 2e-018
gb|CA026473.1|CA026473 HZ56A06r HZ Hordeum vulgare subsp. v... 96 2e-018
>gb|BU977027.1|BU977027 HA10L12r HA Hordeum vulgare subsp. vulgare cDNA clone HA10L12
5-PRIME, mRNA sequence
Length = 472
Score = 95.6 bits (48), Expect = 2e-018
Identities = 87/100 (87%)
Strand = Plus / Plus
Query: 139 gggcggtggtttcttcgtcgctttttcccgggatcagccgcaaaaggtctacgtgcaacc 198
||||||||||||||| || ||||||||| |||||||||| |||||||| || || ||||
Sbjct: 53 gggcggtggtttctttgttgctttttccagggatcagcctcaaaaggtgtatgtacaaca 112
Query: 199 caagataaaggaacagagttcaagactgtggaacttatta 238
|||||||||||| |||||| | ||| |||||||| |||||
Sbjct: 113 caagataaaggagcagagtgcgagagtgtggaacatatta 152
Score = 58.0 bits (29), Expect = 4e-007
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 261 ttgcaggctcttcgacgaaaatgcctgccgatgttacagctgcgctaga 309
||||||| ||||| || ||||||||||| |||||||||||||| |||||
Sbjct: 175 ttgcagggtcttctaccaaaatgcctgctgatgttacagctgcactaga 223
>gb|BU977028.1|BU977028 HA10L12u HA Hordeum vulgare subsp. vulgare cDNA clone HA10L12
3-PRIME, mRNA sequence
Length = 472
Score = 95.6 bits (48), Expect = 2e-018
Identities = 87/100 (87%)
Strand = Plus / Minus
Query: 139 gggcggtggtttcttcgtcgctttttcccgggatcagccgcaaaaggtctacgtgcaacc 198
||||||||||||||| || ||||||||| |||||||||| |||||||| || || ||||
Sbjct: 420 gggcggtggtttctttgttgctttttccagggatcagcctcaaaaggtgtatgtacaaca 361
Query: 199 caagataaaggaacagagttcaagactgtggaacttatta 238
|||||||||||| |||||| | ||| |||||||| |||||
Sbjct: 360 caagataaaggagcagagtgcgagagtgtggaacatatta 321
Score = 58.0 bits (29), Expect = 4e-007
Identities = 44/49 (89%)
Strand = Plus / Minus
Query: 261 ttgcaggctcttcgacgaaaatgcctgccgatgttacagctgcgctaga 309
||||||| ||||| || ||||||||||| |||||||||||||| |||||
Sbjct: 298 ttgcagggtcttctaccaaaatgcctgctgatgttacagctgcactaga 250
>gb|CA026473.1|CA026473 HZ56A06r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ56A06
5-PRIME, mRNA sequence
Length = 503
Score = 95.6 bits (48), Expect = 2e-018
Identities = 87/100 (87%)
Strand = Plus / Plus
Query: 139 gggcggtggtttcttcgtcgctttttcccgggatcagccgcaaaaggtctacgtgcaacc 198
||||||||||||||| || ||||||||| |||||||||| |||||||| || || ||||
Sbjct: 53 gggcggtggtttctttgttgctttttccagggatcagcctcaaaaggtgtatgtacaaca 112
Query: 199 caagataaaggaacagagttcaagactgtggaacttatta 238
|||||||||||| |||||| | ||| |||||||| |||||
Sbjct: 113 caagataaaggagcagagtgcgagagtgtggaacatatta 152
Score = 58.0 bits (29), Expect = 4e-007
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 261 ttgcaggctcttcgacgaaaatgcctgccgatgttacagctgcgctaga 309
||||||| ||||| || ||||||||||| |||||||||||||| |||||
Sbjct: 175 ttgcagggtcttctaccaaaatgcctgctgatgttacagctgcactaga 223
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 44,576
Number of Sequences: 312970
Number of extensions: 44576
Number of successful extensions: 10397
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10388
Number of HSP's gapped (non-prelim): 9
length of query: 666
length of database: 175,134,539
effective HSP length: 19
effective length of query: 647
effective length of database: 169,188,109
effective search space: 109464706523
effective search space used: 109464706523
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)