BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2643622.2.1
(1067 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BI960513.1|BI960513 HVSMEn0024N22f Hordeum vulgare rachi... 502 e-140
gb|AV931728.1|AV931728 AV931728 K. Sato unpublished cDNA li... 462 e-128
gb|AL504160.1|AL504160 AL504160 Hordeum vulgare Barke roots... 430 e-119
gb|BQ664275.1|BQ664275 HV02K08u HV Hordeum vulgare subsp. v... 392 e-108
gb|BG415142.2|BG415142 HVSMEk0005E23f Hordeum vulgare testa... 363 8e-099
gb|BI776301.2|BI776301 EBem04_SQ001_H10_R embryo, 12 DPA, n... 313 7e-084
gb|CB858927.1|CB858927 HI08L23w HI Hordeum vulgare subsp. v... 297 4e-079
gb|BF253422.2|BF253422 HVSMEf0001G02f Hordeum vulgare seedl... 291 2e-077
gb|BI958347.1|BI958347 HVSMEn0014I13f Hordeum vulgare rachi... 289 9e-077
gb|AV915951.1|AV915951 AV915951 K. Sato unpublished cDNA li... 281 2e-074
gb|BF254550.2|BF254550 HVSMEf0004F12f Hordeum vulgare seedl... 246 1e-063
gb|AV921067.1|AV921067 AV921067 K. Sato unpublished cDNA li... 236 1e-060
gb|BF622624.2|BF622624 HVSMEa0007G07f Hordeum vulgare seedl... 127 8e-028
gb|AV836678.1|AV836678 AV836678 K. Sato unpublished cDNA li... 96 3e-018
gb|CA028447.1|CA028447 HZ61P23r HZ Hordeum vulgare subsp. v... 52 4e-005
gb|BQ762245.1|BQ762245 EBro01_SQ005_B10_R root, 3 week, hyd... 50 2e-004
gb|BI952928.1|BI952928 HVSMEm0008H17f Hordeum vulgare green... 48 6e-004
gb|BE519842.2|BE519842 HV_CEb0021G19f Hordeum vulgare seedl... 48 6e-004
gb|BE195199.3|BE195199 HVSMEh0088J02f Hordeum vulgare 5-45 ... 48 6e-004
gb|BQ766377.1|BQ766377 EBro08_SQ005_G19_R root, 3 week, dro... 48 6e-004
gb|CA013705.1|CA013705 HT09E03r HT Hordeum vulgare subsp. v... 48 6e-004
gb|CA016384.1|CA016384 HV09C09u HV Hordeum vulgare subsp. v... 48 6e-004
gb|CA018612.1|CA018612 HV09C09r HV Hordeum vulgare subsp. v... 48 6e-004
gb|AU252316.1|AU252316 AU252316 salt-stressed barley root c... 48 6e-004
gb|BI957225.1|BI957225 HVSMEn0008D16f Hordeum vulgare rachi... 46 0.002
gb|BE216723.1|BE216723 HV_CEb0011F15f Hordeum vulgare seedl... 46 0.002
gb|BI777671.2|BI777671 EBro08_SQ001_F03_R root, 3 week, dro... 46 0.002
gb|BQ767074.1|BQ767074 EBro08_SQ007_L20_R root, 3 week, dro... 46 0.002
gb|AL506174.1|AL506174 AL506174 Hordeum vulgare Barke devel... 44 0.009
gb|AV836988.1|AV836988 AV836988 K. Sato unpublished cDNA li... 44 0.009
gb|BG418784.1|BG418784 HVSMEk0024G18f Hordeum vulgare testa... 44 0.009
gb|BG415719.2|BG415719 HVSMEk0007J06f Hordeum vulgare testa... 44 0.009
gb|BG416585.2|BG416585 HVSMEk0013C22f Hordeum vulgare testa... 44 0.009
gb|BI779253.2|BI779253 EBro01_SQ003_H11_R root, 3 week, hyd... 44 0.009
gb|BU980867.1|BU980867 HA21O21r HA Hordeum vulgare subsp. v... 44 0.009
gb|BU982001.1|BU982001 HA25D20r HA Hordeum vulgare subsp. v... 44 0.009
gb|CA011333.1|CA011333 HT06E05u HT Hordeum vulgare subsp. v... 44 0.009
gb|CA012725.1|CA012725 HT06E05r HT Hordeum vulgare subsp. v... 44 0.009
gb|CA012057.1|CA012057 HT04F04r HT Hordeum vulgare subsp. v... 42 0.037
gb|CB881714.1|CB881714 HM10K16w HM Hordeum vulgare subsp. v... 42 0.037
gb|BI955765.1|BI955765 HVSMEm0024G17f Hordeum vulgare green... 40 0.15
gb|BI960706.1|BI960706 HVSMEn0001B07f Hordeum vulgare rachi... 40 0.15
gb|AV916579.1|AV916579 AV916579 K. Sato unpublished cDNA li... 40 0.15
gb|AJ435273.1|AJ435273 AJ435273 S00002 Hordeum vulgare subs... 40 0.15
gb|BQ758724.1|BQ758724 EBma07_SQ002_J15_R maternal, 21 DPA,... 40 0.15
gb|CA009374.1|CA009374 HU13P05r HU Hordeum vulgare subsp. v... 40 0.15
gb|CA017497.1|CA017497 HV05G05r HV Hordeum vulgare subsp. v... 40 0.15
gb|CA023650.1|CA023650 HZ46P09r HZ Hordeum vulgare subsp. v... 40 0.15
>gb|BI960513.1|BI960513 HVSMEn0024N22f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0024N22f, mRNA sequence
Length = 653
Score = 502 bits (253), Expect = e-140
Identities = 474/548 (86%)
Strand = Plus / Minus
Query: 183 tgtacagctcctccttgtccaggcgcggcgtggcgacggcctgcagcggcgtggccatga 242
|||||||||| ||||| ||||||||||||||||||| |||||||||||||||| ||||||
Sbjct: 560 tgtacagctcntccttctccaggcgcggcgtggcgatggcctgcagcggcgtgcccatga 501
Query: 243 aggtgacgagcccgggggactccatcatgctcacgtcctcggggcaggtcccgctcggca 302
||||||||||||||||||||||||||||||| | |||||| || | ||| || |||||
Sbjct: 500 aggtgacgagcccgggggactccatcatgctaatgtcctccggcctggtgccttccggca 441
Query: 303 gcgtccacgtgaagtggtgcagcatgtggccgatcatggacgccacgaggttgatcccga 362
| | |||| |||| |||||||||||||| ||||||||||| || ||||||||||||||||
Sbjct: 440 gagaccacttgaaatggtgcagcatgtgcccgatcatggaggcgacgaggttgatcccga 381
Query: 363 gctgcgcgccggggcacacccggcggccggcgccgaacggcagcacgcggaagtcggcgc 422
||||||||||||||||||||| ||||| |||||||| |||||||| | |||||| ||
Sbjct: 380 gctgcgcgccggggcacaccctccggcccgcgccgaagggcagcaccctgaagtcactgc 321
Query: 423 ccttgatgtcgatgttctcccggaggaaccgctccggccggaactcgagcgggctgtccc 482
|||||||||||||| ||||| ||||| |||||||||| |||||| ||||| ||| ||
Sbjct: 320 ccttgatgtcgatgctctcctccaggaagcgctccggcctgaactccagcggactgctcc 261
Query: 483 acacctcggggtcgcgcgccaccgcccacacgttgacgacgacgttggcgcccttgggga 542
|||||| |||||| || ||||||||||||||||| || | ||||||||| ||||||||||
Sbjct: 260 acaccttggggtctcgggccaccgcccacacgttcaccatgacgttggcacccttgggga 201
Query: 543 tgtcgtagccggcgatcttgacgctggcgctggccctgtgggggagcatcagcggcgtcg 602
||| ||||||| ||| ||| ||||| ||||||||| ||||||| ||||| ||||||||||
Sbjct: 200 tgttgtagccgccgaccttcacgctcgcgctggccttgtggggcagcatgagcggcgtcg 141
Query: 603 gcgggtgcaggcgcagggactccttgacgactgcctgcaggtaaggcaggttcgggaagt 662
|||||||||| || ||||||||||||||||| ||| |||||| ||||||||| ||||||
Sbjct: 140 gcgggtgcagacggagggactccttgacgacggccatcaggtacggcaggttctggaagt 81
Query: 663 ccgtctccgacaggaccctgtcgcggccgacgacgcggtccagctcctcctgcagcttct 722
| ||||| | || ||| | ||| ||||||||||| ||| |||||||| ||||||||||
Sbjct: 80 cggtctcggccatgacgcggtcacggccgacgacattgtcgagctcctcttgcagcttct 21
Query: 723 cctgcacc 730
|||||||
Sbjct: 20 gctgcacc 13
>gb|AV931728.1|AV931728 AV931728 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd23p07 3', mRNA sequence
Length = 610
Score = 462 bits (233), Expect = e-128
Identities = 395/449 (87%)
Strand = Plus / Plus
Query: 183 tgtacagctcctccttgtccaggcgcggcgtggcgacggcctgcagcggcgtggccatga 242
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||
Sbjct: 162 tgtacagctcctccttctccaggcgcggcgtggcgatggcctgcagcggcgtgcccatga 221
Query: 243 aggtgacgagcccgggggactccatcatgctcacgtcctcggggcaggtcccgctcggca 302
||||||||||||||||||||||||||||||| | |||||| || | ||| || |||||
Sbjct: 222 aggtgacgagcccgggggactccatcatgctaatgtcctccggcctggtgccttccggca 281
Query: 303 gcgtccacgtgaagtggtgcagcatgtggccgatcatggacgccacgaggttgatcccga 362
| | |||| |||| |||||||||||||| ||||||||||| || ||||||||||||||||
Sbjct: 282 gagaccacttgaaatggtgcagcatgtgcccgatcatggaggcgacgaggttgatcccga 341
Query: 363 gctgcgcgccggggcacacccggcggccggcgccgaacggcagcacgcggaagtcggcgc 422
||||||||||||||||||||| ||||| |||||||| |||||||| | |||||| ||
Sbjct: 342 gctgcgcgccggggcacaccctccggcccgcgccgaagggcagcaccctgaagtcactgc 401
Query: 423 ccttgatgtcgatgttctcccggaggaaccgctccggccggaactcgagcgggctgtccc 482
|||||||||||||| ||||| ||||| |||||||||| |||||| ||||| ||| ||
Sbjct: 402 ccttgatgtcgatgctctcctccaggaagcgctccggcctgaactccagcggactgctcc 461
Query: 483 acacctcggggtcgcgcgccaccgcccacacgttgacgacgacgttggcgcccttgggga 542
|||||| |||||| || ||||||||||||||||| || | ||||||||| ||||||||||
Sbjct: 462 acaccttggggtctcgggccaccgcccacacgttcaccatgacgttggcacccttgggga 521
Query: 543 tgtcgtagccggcgatcttgacgctggcgctggccctgtgggggagcatcagcggcgtcg 602
||| ||||||| ||| ||||||||| ||||||||| ||||||| ||||| ||||||||||
Sbjct: 522 tgttgtagccgccgaccttgacgctcgcgctggccttgtggggcagcatgagcggcgtcg 581
Query: 603 gcgggtgcaggcgcagggactccttgacg 631
|||||||||| || |||||||||||||||
Sbjct: 582 gcgggtgcagacggagggactccttgacg 610
>gb|AL504160.1|AL504160 AL504160 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW04G02V 5', mRNA sequence
Length = 606
Score = 430 bits (217), Expect = e-119
Identities = 394/452 (87%), Gaps = 1/452 (0%)
Strand = Plus / Plus
Query: 183 tgtacagctcctccttgtccaggcgcggcgtggcgacggcctgcagcggcgtggccatga 242
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||
Sbjct: 137 tgtacagctcctccttctccaggcgcggcgtggcgatggcctgcagcggcgtgcccatga 196
Query: 243 aggtgacgagcccgggggactccatcatgctcacgtcctcggggcaggtcccgctcggca 302
||||||||||||||||||||||||||||||| | |||||| || | || || |||||
Sbjct: 197 aggtgacgagcccgggggactccatcatgctaatgtcctccggcctggngccttccggca 256
Query: 303 gcgtccacgtgaagtggtgcagcatgtggccgatcatggacgccacgaggttgatcccga 362
| | |||| |||| |||||||||||||| ||||||||||| || ||||||||||||||||
Sbjct: 257 gagaccacttgaaatggtgcagcatgtgcccgatcatggaggcgacgaggttgatcccga 316
Query: 363 gctgcgcgccggggcacacccggcggccggcgccgaacggcagcacgcggaagtcggcgc 422
||||||||||||||||||||| ||||| |||||||| |||||||| | |||||| ||
Sbjct: 317 gctgcgcgccggggcacaccctccggcccgcgccgaagggcagcaccctgaagtcactgc 376
Query: 423 ccttgatgtcgatgttctcccggaggaaccgctccggccggaactcgagcgggctgtccc 482
|||||||||||||| ||||| ||||| |||||||||| |||||| ||||| ||| ||
Sbjct: 377 ccttgatgtcgatgctctcctccaggaagcgctccggcctgaactccagcggactgctcc 436
Query: 483 acacctcggggtcgcgcgccaccgcccacacgttgacgacgacgttggcgcccttgggga 542
|||||| |||||| || ||||||||||||||||| || | ||||||||| ||||||||||
Sbjct: 437 acaccttggggtctcgggccaccgcccacacgttcaccatgacgttggcacccttgggga 496
Query: 543 tgtcgtagccggcgatcttgacgctggcgctggccctgtgggg-gagcatcagcggcgtc 601
||| ||||||| ||| ||||||||| ||||||||| ||||||| ||||| ||||||||
Sbjct: 497 tgttgtagccgccgaccttgacgctcgcgctggccttgtggggcaagcatgagcggcgtt 556
Query: 602 ggcgggtgcaggcgcagggactccttgacgac 633
|||||||||| || |||||||||||||||||
Sbjct: 557 tgcgggtgcagacggagggactccttgacgac 588
>gb|BQ664275.1|BQ664275 HV02K08u HV Hordeum vulgare subsp. vulgare cDNA clone HV02K08
3-PRIME, mRNA sequence
Length = 568
Score = 392 bits (198), Expect = e-108
Identities = 345/394 (87%)
Strand = Plus / Plus
Query: 183 tgtacagctcctccttgtccaggcgcggcgtggcgacggcctgcagcggcgtggccatga 242
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||
Sbjct: 175 tgtacagctcctccttctccaggcgcggcgtggcgatggcctgcagcggcgtgcccatga 234
Query: 243 aggtgacgagcccgggggactccatcatgctcacgtcctcggggcaggtcccgctcggca 302
||||||||||||||||||||||||||||||| | |||||| || | ||| || |||||
Sbjct: 235 aggtgacgagcccgggggactccatcatgctaatgtcctccggcctggtgccttccggca 294
Query: 303 gcgtccacgtgaagtggtgcagcatgtggccgatcatggacgccacgaggttgatcccga 362
| | |||| |||| |||||||||||||| ||||||||||| || ||||||||||||||||
Sbjct: 295 gagaccacttgaaatggtgcagcatgtgcccgatcatggaggcgacgaggttgatcccga 354
Query: 363 gctgcgcgccggggcacacccggcggccggcgccgaacggcagcacgcggaagtcggcgc 422
||||||||||||||||||||| ||||| |||||||| |||||||| | |||||| ||
Sbjct: 355 gctgcgcgccggggcacaccctccggcccgcgccgaagggcagcaccctgaagtcactgc 414
Query: 423 ccttgatgtcgatgttctcccggaggaaccgctccggccggaactcgagcgggctgtccc 482
|||||||||||||| ||||| ||||| |||||||||| |||||| ||||| ||| ||
Sbjct: 415 ccttgatgtcgatgctctcctccaggaagcgctccggcctgaactccagcggactgctcc 474
Query: 483 acacctcggggtcgcgcgccaccgcccacacgttgacgacgacgttggcgcccttgggga 542
|||||| |||||| || ||||||||||||||||| || | ||||||||| ||||||||||
Sbjct: 475 acaccttggggtctcgggccaccgcccacacgttcaccatgacgttggcacccttgggga 534
Query: 543 tgtcgtagccggcgatcttgacgctggcgctggc 576
||| ||||||| ||| ||||||||| ||||||||
Sbjct: 535 tgttgtagccgccgaccttgacgctcgcgctggc 568
>gb|BG415142.2|BG415142 HVSMEk0005E23f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0005E23f, mRNA sequence
Length = 922
Score = 363 bits (183), Expect = 8e-099
Identities = 456/547 (83%)
Strand = Plus / Minus
Query: 318 ggtgcagcatgtggccgatcatggacgccacgaggttgatcccgagctgcgcgccggggc 377
||||||||||| |||||||||| || || ||||||||||| |||| || ||||||||||
Sbjct: 567 ggtgcagcatggggccgatcattgaggcgacgaggttgattccgaaatgagcgccggggc 508
Query: 378 acacccggcggccggcgccgaacggcagcacgcggaagtcggcgcccttgatgtcgatgt 437
|||||| ||||| |||||||| |||||||| | |||||| ||||||||||||||||
Sbjct: 507 acaccctccggcccgcgccgaagggcagcaccctgaagtcaatgcccttgatgtcgatgc 448
Query: 438 tctcccggaggaaccgctccggccggaactcgagcgggctgtcccacacctcggggtcgc 497
||||| ||| | |||||||||| |||||| ||||| ||| |||||||| |||||| |
Sbjct: 447 tctcctccagggagcgctccggcctgaactccagcggactggtccacaccttggggtctc 388
Query: 498 gcgccaccgcccacacgttgacgacgacgttggcgcccttggggatgtcgtagccggcga 557
| ||||||||||||||||| || | ||||||||| ||||||||||||| ||||||| |||
Sbjct: 387 gggccaccgcccacacgttcaccatgacgttggcacccttggggatgttgtagccgccga 328
Query: 558 tcttgacgctggcgctggccctgtgggggagcatcagcggcgtcggcgggtgcaggcgca 617
||||||||| ||||||||| ||||||| ||||| |||||||||||||||||||| || |
Sbjct: 327 ccttgacgctcgcgctggccttgtggggcagcatgagcggcgtcggcgggtgcagacgga 268
Query: 618 gggactccttgacgactgcctgcaggtaaggcaggttcgggaagtccgtctccgacagga 677
|||||||||||||||| || |||||| ||||||||| ||||||| ||||| | || ||
Sbjct: 267 gggactccttgacgacgtccatcaggtacggcaggttctggaagtcggtctcggccatga 208
Query: 678 ccctgtcgcggccgacgacgcggtccagctcctcctgcagcttctcctgcaccctggggt 737
| | ||| ||||||||||| ||| |||||||| |||||||||| |||||||||||| |
Sbjct: 207 cgcggtcacggccgacgacattgtcgagctcctcttgcagcttctgctgcaccctgggat 148
Query: 738 tcctcagcagctccgccatcgcccactacaccgagatcaccgtcgtgtccgtgccggcgg 797
|||| | |||||| ||||| ||||| | || || || || ||||||||| | || ||||
Sbjct: 147 tcctgaccagctctgccatggcccattcgactgatatgactgtcgtgtccatcccagcgg 88
Query: 798 tgatcatgtcccagaggaggcctatgacggtgtcgtcgctgaggtcgtacttgtccctga 857
||||||||||||| || || || | || ||||| || || ||||| ||||| || ||||
Sbjct: 87 tgatcatgtcccatagaagtccgaaaactgtgtcatcactaaggtcatacttctctctga 28
Query: 858 gagtgaa 864
|||||||
Sbjct: 27 gagtgaa 21
>gb|BI776301.2|BI776301 EBem04_SQ001_H10_R embryo, 12 DPA, no treatment, cv Optic, EBem04
Hordeum vulgare subsp. vulgare cDNA clone
EBem04_SQ001_H10 5', mRNA sequence
Length = 537
Score = 313 bits (158), Expect = 7e-084
Identities = 407/490 (83%)
Strand = Plus / Minus
Query: 421 gcccttgatgtcgatgttctcccggaggaaccgctccggccggaactcgagcgggctgtc 480
|||||||||||||||| ||||| ||||| |||||||||| |||||| ||||| |||
Sbjct: 528 gcccttgatgtcgatgctctcctccaggaagcgctccggcctgaactccagcggactgct 469
Query: 481 ccacacctcggggtcgcgcgccaccgcccacacgttgacgacgacgttggcgcccttggg 540
|||||||| |||||| || ||||||||||||||||| || | ||||||||| ||||||||
Sbjct: 468 ccacaccttggggtctcgggccaccgcccacacgttcaccatgacgttggcacccttggg 409
Query: 541 gatgtcgtagccggcgatcttgacgctggcgctggccctgtgggggagcatcagcggcgt 600
||||| ||||||| ||| ||||||||| ||||||||| ||||||| ||||| ||||||||
Sbjct: 408 gatgttgtagccgccgaccttgacgctcgcgctggccttgtggggcagcatgagcggcgt 349
Query: 601 cggcgggtgcaggcgcagggactccttgacgactgcctgcaggtaaggcaggttcgggaa 660
|||||||||||| || ||||||||||||||||| ||| |||||| ||||||||| ||||
Sbjct: 348 cggcgggtgcagacggagggactccttgacgacggccatcaggtacggcaggttctggaa 289
Query: 661 gtccgtctccgacaggaccctgtcgcggccgacgacgcggtccagctcctcctgcagctt 720
||| ||||| | || ||| | ||| ||||||||||| ||| |||||||| ||||||||
Sbjct: 288 gtcggtctcggccatgacgcggtcacggccgacgacattgtcgagctcctcttgcagctt 229
Query: 721 ctcctgcaccctggggttcctcagcagctccgccatcgcccactacaccgagatcaccgt 780
|| |||||||||||| ||||| | |||||| ||||| ||||| | || || || || ||
Sbjct: 228 ctgctgcaccctgggattcctgaccagctctgccatggcccattcgactgatatgactgt 169
Query: 781 cgtgtccgtgccggcggtgatcatgtcccagaggaggcctatgacggtgtcgtcgctgag 840
||||||| | || ||||||||||||||||| || || || | || ||||| || || ||
Sbjct: 168 cgtgtccatcccagcggtgatcatgtcccatagaagtccgaaaactgtgtcatcactaag 109
Query: 841 gtcgtacttgtccctgagagtgaagagcgcgtcgacgaagtgctgctgggcgccgcgctg 900
||| ||||| || ||||||||||| || || || || |||||||| | || |||| ||
Sbjct: 108 gtcatacttctctctgagagtgaacagtgcatccacaaagtgctgtttagcaccgctctc 49
Query: 901 cttgagggcc 910
||||||||||
Sbjct: 48 cttgagggcc 39
>gb|CB858927.1|CB858927 HI08L23w HI Hordeum vulgare subsp. vulgare cDNA clone HI08L23
3-PRIME, mRNA sequence
Length = 663
Score = 297 bits (150), Expect = 4e-079
Identities = 298/344 (86%), Gaps = 5/344 (1%)
Strand = Plus / Plus
Query: 725 tgcaccctggggttcctcagcagctccgccatcgcccactacaccgagatcaccgtcgtg 784
||||||||||||||||||| ||||||||| | |||||||| ||| | ||||||||||||
Sbjct: 322 tgcaccctggggttcctcaccagctccgctaccgcccactccacggttatcaccgtcgtg 381
Query: 785 tccgtgccggcggtgatcatgtcccagaggaggcctatgacggtgtcgtcgctgaggtcg 844
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 382 tccgtgccggcggtgatcatgtcccagaggaggccaatgacggtgtcgtcgctgaggtcg 441
Query: 845 tacttgtccctgagagtgaagagcgcgtcgacgaagtgctgct---gggcgccgcgctgc 901
|||||||||| ||| |||||||||||||||||||| ||||||| || ||||| | ||
Sbjct: 442 tacttgtcccggagcgtgaagagcgcgtcgacgaaatgctgcttgctggtgccgctccgc 501
Query: 902 ttgagggccctggcgtgctcctccatgatcttcacggtgaggcggtcgcgccgttcgccg 961
| | ||||||||||||||||||||||||||| |||||||| |||||||||| ||||||
Sbjct: 502 tcaaaggccctggcgtgctcctccatgatcttgacggtgagccggtcgcgcctgtcgccg 561
Query: 962 tgggctttgaaggcctgctcgtcgtccggggccagccagcgcagccacggtatgtgctgc 1021
||||||| ||||| ||||||| |||| | || || || |||||||| |||||||
Sbjct: 562 tgggcttgataggccacctcgtcgaccggcgtgag-caccggagccacgg-atgtgctcg 619
Query: 1022 gcgatggagagggacgcaccgatcttgatgccgttgtggacgat 1065
|||||||| || ||||| ||||||||||| ||||| | ||||||
Sbjct: 620 gcgatggacagcgacgcgccgatcttgatcccgttattgacgat 663
Score = 97.6 bits (49), Expect = 7e-019
Identities = 79/89 (88%)
Strand = Plus / Plus
Query: 183 tgtacagctcctccttgtccaggcgcggcgtggcgacggcctgcagcggcgtggccatga 242
|||| ||||||||||| || |||||||||||||||||| | |||||||||||| |||||
Sbjct: 185 tgtagagctcctccttttcgaggcgcggcgtggcgacgacttgcagcggcgtgcgcatga 244
Query: 243 aggtgacgagcccgggggactccatcatg 271
| |||| |||||||||||||||||||||
Sbjct: 245 atgtgattagcccgggggactccatcatg 273
>gb|BF253422.2|BF253422 HVSMEf0001G02f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0001G02f, mRNA sequence
Length = 617
Score = 291 bits (147), Expect = 2e-077
Identities = 407/494 (82%)
Strand = Plus / Minus
Query: 392 gcgccgaacggcagcacgcggaagtcggcgcccttgatgtcgatgttctcccggaggaac 451
|||| ||| |||||||| | |||||| |||||||||||||||| ||||| || ||
Sbjct: 614 gcgcngaagggcagcaccctgaagtcactgcccttgatgtcgatgctctcctccagaaag 555
Query: 452 cgctccggccggaactcgagcgggctgtcccacacctcggggtcgcgcgccaccgcccac 511
||||||||| |||||| ||||| ||| |||||| | |||||| || ||||||||||||
Sbjct: 554 cgctccggcttgaactccagcggactgctccacacattggggtctcgggccaccgcccac 495
Query: 512 acgttgacgacgacgttggcgcccttggggatgtcgtagccggcgatcttgacgctggcg 571
||||| || | ||||||||| ||||||||||||| ||||||| ||| ||||||||| |||
Sbjct: 494 acgttcaccatgacgttggcacccttggggatgttgtagccgccgaccttgacgctcgcg 435
Query: 572 ctggccctgtgggggagcatcagcggcgtcggcgggtgcaggcgcagggactccttgacg 631
|||||| ||||||| ||||| |||||||||||||||||||| || |||||||||||||||
Sbjct: 434 ctggccttgtggggcagcatgagcggcgtcggcgggtgcagacggagggactccttgacg 375
Query: 632 actgcctgcaggtaaggcaggttcgggaagtccgtctccgacaggaccctgtcgcggccg 691
|| ||| |||||| ||||||||| ||||||| ||||| | || ||| | ||| ||||||
Sbjct: 374 acggccatcaggtacggcaggttctggaagtcggtctcggccatgacgcggtcacggccg 315
Query: 692 acgacgcggtccagctcctcctgcagcttctcctgcaccctggggttcctcagcagctcc 751
||||| ||| |||||||| |||||||||| |||||||||||| ||||| | ||||||
Sbjct: 314 acgacattgtcgagctcctcttgcagcttctgctgcaccctgggattcctgaccagctct 255
Query: 752 gccatcgcccactacaccgagatcaccgtcgtgtccgtgccggcggtgatcatgtcccag 811
||||| ||||| | || || || || ||||||||| | || |||||||||||||||||
Sbjct: 254 gccatggcccattcgactgatatgactgtcgtgtccatcccagcggtgatcatgtcccat 195
Query: 812 aggaggcctatgacggtgtcgtcgctgaggtcgtacttgtccctgagagtgaagagcgcg 871
|| || || | || ||||| || || ||||| ||||| || ||||||||||| || ||
Sbjct: 194 agaagtccgaaaactgtgtcatcactaaggtcatacttctctctgagagtgaacagtgca 135
Query: 872 tcgacgaagtgctg 885
|| || ||||||||
Sbjct: 134 tccacaaagtgctg 121
>gb|BI958347.1|BI958347 HVSMEn0014I13f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0014I13f, mRNA sequence
Length = 757
Score = 289 bits (146), Expect = 9e-077
Identities = 251/286 (87%)
Strand = Plus / Plus
Query: 183 tgtacagctcctccttgtccaggcgcggcgtggcgacggcctgcagcggcgtggccatga 242
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||
Sbjct: 445 tgtacagctcctccttctccaggcgcggcgtggcgatggcctgcagcggcgtgcccatga 504
Query: 243 aggtgacgagcccgggggactccatcatgctcacgtcctcggggcaggtcccgctcggca 302
||||||||||||||||||||||||||||||| | |||||| || | ||| || |||||
Sbjct: 505 aggtgacgagcccgggggactccatcatgctaatgtcctccggcctggtgccttccggca 564
Query: 303 gcgtccacgtgaagtggtgcagcatgtggccgatcatggacgccacgaggttgatcccga 362
| | |||| |||| |||||||||||||| ||||||||||| || ||||||||||||||||
Sbjct: 565 gagaccacttgaaatggtgcagcatgtgcccgatcatggaggcgacgaggttgatcccga 624
Query: 363 gctgcgcgccggggcacacccggcggccggcgccgaacggcagcacgcggaagtcggcgc 422
||||||||||||||||||||| ||||| |||||||| |||||||| | |||||| ||
Sbjct: 625 gctgcgcgccggggcacaccctccggcccgcgccgaaaggcagcaccccgaagtcactgc 684
Query: 423 ccttgatgtcgatgttctcccggaggaaccgctccggccggaactc 468
|||||||||| ||| ||||| ||||| |||||||||| ||||||
Sbjct: 685 ccttgatgtcaatgctctcctccaggaagcgctccggcctgaactc 730
>gb|AV915951.1|AV915951 AV915951 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags16m22 5', mRNA sequence
Length = 395
Score = 281 bits (142), Expect = 2e-074
Identities = 226/254 (88%)
Strand = Plus / Minus
Query: 183 tgtacagctcctccttgtccaggcgcggcgtggcgacggcctgcagcggcgtggccatga 242
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||
Sbjct: 282 tgtacagctcctccttctccaggcgcggcgtggcgatggcctgcagcggcgtgcccatga 223
Query: 243 aggtgacgagcccgggggactccatcatgctcacgtcctcggggcaggtcccgctcggca 302
||||||||||||||||||||||||||||||| | |||||| || | ||| || |||||
Sbjct: 222 aggtgacgagcccgggggactccatcatgctaatgtcctccggcctggtgccttccggca 163
Query: 303 gcgtccacgtgaagtggtgcagcatgtggccgatcatggacgccacgaggttgatcccga 362
| | |||| |||| |||||||||||||| ||||||||||| || ||||||||||||||||
Sbjct: 162 gagaccacttgaaatggtgcagcatgtgcccgatcatggaggcgacgaggttgatcccga 103
Query: 363 gctgcgcgccggggcacacccggcggccggcgccgaacggcagcacgcggaagtcggcgc 422
||||||||||||||||||||| ||||| |||||||| |||||||| | |||||| ||
Sbjct: 102 gctgcgcgccggggcacaccctccggcccgcgccgaagggcagcaccctgaagtcactgc 43
Query: 423 ccttgatgtcgatg 436
||||||||||||||
Sbjct: 42 ccttgatgtcgatg 29
>gb|BF254550.2|BF254550 HVSMEf0004F12f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0004F12f, mRNA sequence
Length = 799
Score = 246 bits (124), Expect = 1e-063
Identities = 193/216 (89%)
Strand = Plus / Minus
Query: 528 tggcgcccttggggatgtcgtagccggcgatcttgacgctggcgctggccctgtggggga 587
|||| ||||||||||||| ||||||||||| ||| ||| |||||||||| |||| ||||
Sbjct: 231 tggctcccttggggatgtagtagccggcgaccttcacgtcggcgctggccttgtgcggga 172
Query: 588 gcatcagcggcgtcggcgggtgcaggcgcagggactccttgacgactgcctgcaggtaag 647
||||||||||||||||||||||||| || || |||||||| ||||| ||||||||||| |
Sbjct: 171 gcatcagcggcgtcggcgggtgcagccggagcgactccttcacgacggcctgcaggtacg 112
Query: 648 gcaggttcgggaagtccgtctccgacaggaccctgtcgcggccgacgacgcggtccagct 707
||||| |||| ||||||||||||||||| |||| |||||||||||| || ||||||||||
Sbjct: 111 gcaggctcggtaagtccgtctccgacagcacccggtcgcggccgaccacccggtccagct 52
Query: 708 cctcctgcagcttctcctgcaccctggggttcctca 743
||||||||| ||| | ||||||||||||||||||||
Sbjct: 51 cctcctgcaccttgtgctgcaccctggggttcctca 16
>gb|AV921067.1|AV921067 AV921067 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags16m22 3', mRNA sequence
Length = 493
Score = 236 bits (119), Expect = 1e-060
Identities = 180/201 (89%)
Strand = Plus / Plus
Query: 183 tgtacagctcctccttgtccaggcgcggcgtggcgacggcctgcagcggcgtggccatga 242
|||||||||||| ||| ||||||||||||||||||| |||||||||||||||| ||||||
Sbjct: 288 tgtacagctcctncttctccaggcgcggcgtggcgatggcctgcagcggcgtgcccatga 347
Query: 243 aggtgacgagcccgggggactccatcatgctcacgtcctcggggcaggtcccgctcggca 302
||||||||||||||||||||||||||||||| | |||||| || | ||| || |||||
Sbjct: 348 aggtgacgagcccgggggactccatcatgctaatgtcctccggcctggtgccttncggca 407
Query: 303 gcgtccacgtgaagtggtgcagcatgtggccgatcatggacgccacgaggttgatcccga 362
| | |||| |||| ||||||| |||||| ||||||||||| || ||||||||||||||||
Sbjct: 408 gagaccacttgaaatggtgcaacatgtgcccgatcatggaggcgacgaggttgatcccga 467
Query: 363 gctgcgcgccggggcacaccc 383
|||||||||||||||||||||
Sbjct: 468 gctgcgcgccggggcacaccc 488
>gb|BF622624.2|BF622624 HVSMEa0007G07f Hordeum vulgare seedling shoot EST library
HVcDNA0001 (Cold stress) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEa0007G07f, mRNA sequence
Length = 690
Score = 127 bits (64), Expect = 8e-028
Identities = 91/100 (91%)
Strand = Plus / Plus
Query: 183 tgtacagctcctccttgtccaggcgcggcgtggcgacggcctgcagcggcgtggccatga 242
||||||| |||||||| ||||||||||||||||| | |||||||| || |||| ||||||
Sbjct: 329 tgtacagttcctccttctccaggcgcggcgtggcaatggcctgcaacgccgtgcccatga 388
Query: 243 aggtgacgagcccgggggactccatcatgctcacgtcctc 282
||||||||||||||||||||||||||||||| | ||||||
Sbjct: 389 aggtgacgagcccgggggactccatcatgctaatgtcctc 428
>gb|AV836678.1|AV836678 AV836678 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
vulgare seedling leaves second leaf stage Hordeum
vulgare subsp. vulgare cDNA clone basd23p07, mRNA
sequence
Length = 501
Score = 95.6 bits (48), Expect = 3e-018
Identities = 217/272 (79%), Gaps = 1/272 (0%)
Strand = Plus / Minus
Query: 640 caggtaaggcaggttcgggaagtccgtctccgac-aggaccctgtcgcggccgacgacgc 698
|||||| ||||||||| ||||||| ||||| | | | ||| | ||| |||||||||||
Sbjct: 485 caggtacggcaggttctggaagtcggtctcgggccatgacgcggtcacggccgacgacat 426
Query: 699 ggtccagctcctcctgcagcttctcctgcaccctggggttcctcagcagctccgccatcg 758
||| |||||||| |||||||||| |||||||||||| ||||| | |||||| ||||| |
Sbjct: 425 tgtcgagctcctcttgcagcttctgctgcaccctgggattcctgaccagctctgccatgg 366
Query: 759 cccactacaccgagatcaccgtcgtgtccgtgccggcggtgatcatgtcccagaggaggc 818
|||| | || || || || ||||||||| | || ||||||||||||||||| || || |
Sbjct: 365 cccattcgactgatatgactgtcgtgtccatcccagcggtgatcatgtcccatagaagtc 306
Query: 819 ctatgacggtgtcgtcgctgaggtcgtacttgtccctgagagtgaagagcgcgtcgacga 878
| | || ||||| || || ||||| ||||| || ||||||||||| || || || || |
Sbjct: 305 cgaaaactgtgtcatcactaaggtcatacttctctctgagagtgaacagtgcatccacaa 246
Query: 879 agtgctgctgggcgccgcgctgcttgagggcc 910
||||||| | || |||| || ||||||||||
Sbjct: 245 agtgctgtttagcaccgctctccttgagggcc 214
>gb|CA028447.1|CA028447 HZ61P23r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ61P23
5-PRIME, mRNA sequence
Length = 580
Score = 52.0 bits (26), Expect = 4e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 727 caccctggggttcctcagcagctccgccatcgcccact 764
|||||| ||||||||||| ||||||||||| |||||||
Sbjct: 333 caccctcgggttcctcagtagctccgccatggcccact 296
>gb|BQ762245.1|BQ762245 EBro01_SQ005_B10_R root, 3 week, hydroponic grown, no treatment, cv
Optic, EBro01 Hordeum vulgare subsp. vulgare cDNA clone
EBro01_SQ005_B10 5', mRNA sequence
Length = 537
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 445 gaggaaccgctccggccggaactcg 469
|||||||||||||||||||||||||
Sbjct: 84 gaggaaccgctccggccggaactcg 60
>gb|BI952928.1|BI952928 HVSMEm0008H17f Hordeum vulgare green seedling EST library
HVcDNA0014 (Blumeria infected) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEm0008H17f, mRNA sequence
Length = 872
Score = 48.1 bits (24), Expect = 6e-004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 446 aggaaccgctccggccggaactcg 469
||||||||||||||||||||||||
Sbjct: 406 aggaaccgctccggccggaactcg 383
>gb|BE519842.2|BE519842 HV_CEb0021G19f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0021G19f, mRNA sequence
Length = 611
Score = 48.1 bits (24), Expect = 6e-004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 446 aggaaccgctccggccggaactcg 469
||||||||||||||||||||||||
Sbjct: 223 aggaaccgctccggccggaactcg 200
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 370 gccggggcacacccggcggccggcgccgaacggca 404
||||||||||| |||||| ||||||||||| ||||
Sbjct: 314 gccggggcacaaccggcgtccggcgccgaaaggca 280
>gb|BE195199.3|BE195199 HVSMEh0088J02f Hordeum vulgare 5-45 DAP spike EST library
HVcDNA0009 (5 to 45 DAP) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEh0088J02f, mRNA sequence
Length = 624
Score = 48.1 bits (24), Expect = 6e-004
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 374 gggcacacccggcggccggcgccgaacggcag 405
||||||| || |||||||||||||||||||||
Sbjct: 396 gggcacatcctgcggccggcgccgaacggcag 365
>gb|BQ766377.1|BQ766377 EBro08_SQ005_G19_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ005_G19 5', mRNA sequence
Length = 401
Score = 48.1 bits (24), Expect = 6e-004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 446 aggaaccgctccggccggaactcg 469
||||||||||||||||||||||||
Sbjct: 34 aggaaccgctccggccggaactcg 11
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 370 gccggggcacacccggcggccggcgccgaacggca 404
||||||||||| |||||| ||||||||||| ||||
Sbjct: 125 gccggggcacaaccggcgtccggcgccgaaaggca 91
>gb|CA013705.1|CA013705 HT09E03r HT Hordeum vulgare subsp. vulgare cDNA clone HT09E03
5-PRIME, mRNA sequence
Length = 609
Score = 48.1 bits (24), Expect = 6e-004
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 374 gggcacacccggcggccggcgccgaacggcag 405
||||||| || |||||||||||||||||||||
Sbjct: 471 gggcacatcctgcggccggcgccgaacggcag 440
>gb|CA016384.1|CA016384 HV09C09u HV Hordeum vulgare subsp. vulgare cDNA clone HV09C09
3-PRIME, mRNA sequence
Length = 509
Score = 48.1 bits (24), Expect = 6e-004
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 446 aggaaccgctccggccggaactcg 469
||||||||||||||||||||||||
Sbjct: 369 aggaaccgctccggccggaactcg 392
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 370 gccggggcacacccggcggccggcgccgaacggca 404
||||||||||| |||||| ||||||||||| ||||
Sbjct: 278 gccggggcacaaccggcgtccggcgccgaaaggca 312
>gb|CA018612.1|CA018612 HV09C09r HV Hordeum vulgare subsp. vulgare cDNA clone HV09C09
5-PRIME, mRNA sequence
Length = 653
Score = 48.1 bits (24), Expect = 6e-004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 446 aggaaccgctccggccggaactcg 469
||||||||||||||||||||||||
Sbjct: 372 aggaaccgctccggccggaactcg 349
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 370 gccggggcacacccggcggccggcgccgaacggca 404
||||||||||| |||||| ||||||||||| ||||
Sbjct: 463 gccggggcacaaccggcgtccggcgccgaaaggca 429
>gb|AU252316.1|AU252316 AU252316 salt-stressed barley root cDNA Hordeum vulgare subsp.
vulgare cDNA clone BR-C09 similar to putative cytochrome
P450, mRNA sequence
Length = 1066
Score = 48.1 bits (24), Expect = 6e-004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 446 aggaaccgctccggccggaactcg 469
||||||||||||||||||||||||
Sbjct: 667 aggaaccgctccggccggaactcg 644
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 370 gccggggcacacccggcggccggcgccgaacggca 404
||||||||||| |||||| ||||||||||| ||||
Sbjct: 758 gccggggcacaaccggcgtccggcgccgaaaggca 724
>gb|BI957225.1|BI957225 HVSMEn0008D16f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0008D16f, mRNA sequence
Length = 622
Score = 46.1 bits (23), Expect = 0.002
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 684 cgcggccgacgacgcggtccagctcctcctg 714
||||||||||||| ||||||| |||||||||
Sbjct: 307 cgcggccgacgacacggtccatctcctcctg 277
>gb|BE216723.1|BE216723 HV_CEb0011F15f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0011F15f, mRNA sequence
Length = 883
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 370 gccggggcacacccggcggccggcgccgaacggca 404
||||||||||| |||||| ||||||||||| ||||
Sbjct: 395 gccggggcacaaccggcgtccggcgccgaaaggca 429
>gb|BI777671.2|BI777671 EBro08_SQ001_F03_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ001_F03 5', mRNA sequence
Length = 353
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 370 gccggggcacacccggcggccggcgccgaacggca 404
||||||||||| |||||| ||||||||||| ||||
Sbjct: 90 gccggggcacaaccggcgtccggcgccgaaaggca 56
>gb|BQ767074.1|BQ767074 EBro08_SQ007_L20_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ007_L20 5', mRNA sequence
Length = 330
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 370 gccggggcacacccggcggccggcgccgaacggca 404
||||||||||| |||||| ||||||||||| ||||
Sbjct: 52 gccggggcacaaccggcgtccggcgccgaaaggca 18
>gb|AL506174.1|AL506174 AL506174 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY02E13T 5',
mRNA sequence
Length = 700
Score = 44.1 bits (22), Expect = 0.009
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 776 accgtcgtgtccgtgccggcgg 797
||||||||||||||||||||||
Sbjct: 618 accgtcgtgtccgtgccggcgg 639
>gb|AV836988.1|AV836988 AV836988 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
vulgare seedling leaves second leaf stage Hordeum
vulgare subsp. vulgare cDNA clone basd21h06, mRNA
sequence
Length = 504
Score = 44.1 bits (22), Expect = 0.009
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 370 gccggggcacacccggcggccggcgccgaacggcagca 407
||||||||||| ||| |||||||| ||||| |||||||
Sbjct: 401 gccggggcacatccgccggccggccccgaatggcagca 438
>gb|BG418784.1|BG418784 HVSMEk0024G18f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0024G18f, mRNA sequence
Length = 845
Score = 44.1 bits (22), Expect = 0.009
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 450 accgctccggccggaactcgag 471
||||||||||||||||||||||
Sbjct: 33 accgctccggccggaactcgag 12
>gb|BG415719.2|BG415719 HVSMEk0007J06f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0007J06f, mRNA sequence
Length = 614
Score = 44.1 bits (22), Expect = 0.009
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 450 accgctccggccggaactcgag 471
||||||||||||||||||||||
Sbjct: 297 accgctccggccggaactcgag 276
>gb|BG416585.2|BG416585 HVSMEk0013C22f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0013C22f, mRNA sequence
Length = 552
Score = 44.1 bits (22), Expect = 0.009
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 450 accgctccggccggaactcgag 471
||||||||||||||||||||||
Sbjct: 24 accgctccggccggaactcgag 3
>gb|BI779253.2|BI779253 EBro01_SQ003_H11_R root, 3 week, hydroponic grown, no treatment, cv
Optic, EBro01 Hordeum vulgare subsp. vulgare cDNA clone
EBro01_SQ003_H11 5', mRNA sequence
Length = 489
Score = 44.1 bits (22), Expect = 0.009
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 623 tccttgacgactgcctgcaggtaagg 648
||||||||||| ||||||||||||||
Sbjct: 327 tccttgacgacggcctgcaggtaagg 302
>gb|BU980867.1|BU980867 HA21O21r HA Hordeum vulgare subsp. vulgare cDNA clone HA21O21
5-PRIME, mRNA sequence
Length = 166
Score = 44.1 bits (22), Expect = 0.009
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 450 accgctccggccggaactcgag 471
||||||||||||||||||||||
Sbjct: 50 accgctccggccggaactcgag 29
>gb|BU982001.1|BU982001 HA25D20r HA Hordeum vulgare subsp. vulgare cDNA clone HA25D20
5-PRIME, mRNA sequence
Length = 349
Score = 44.1 bits (22), Expect = 0.009
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 450 accgctccggccggaactcgag 471
||||||||||||||||||||||
Sbjct: 83 accgctccggccggaactcgag 62
>gb|CA011333.1|CA011333 HT06E05u HT Hordeum vulgare subsp. vulgare cDNA clone HT06E05
3-PRIME, mRNA sequence
Length = 549
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 370 gccggggcacacccggcggccggcgccgaa 399
||||||||||| || |||||||||||||||
Sbjct: 398 gccggggcacatcctgcggccggcgccgaa 427
Score = 42.1 bits (21), Expect = 0.037
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 448 gaaccgctccggccggaactc 468
|||||||||||||||||||||
Sbjct: 485 gaaccgctccggccggaactc 505
>gb|CA012725.1|CA012725 HT06E05r HT Hordeum vulgare subsp. vulgare cDNA clone HT06E05
5-PRIME, mRNA sequence
Length = 700
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 370 gccggggcacacccggcggccggcgccgaa 399
||||||||||| || |||||||||||||||
Sbjct: 342 gccggggcacatcctgcggccggcgccgaa 313
Score = 42.1 bits (21), Expect = 0.037
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 448 gaaccgctccggccggaactc 468
|||||||||||||||||||||
Sbjct: 255 gaaccgctccggccggaactc 235
>gb|CA012057.1|CA012057 HT04F04r HT Hordeum vulgare subsp. vulgare cDNA clone HT04F04
5-PRIME, mRNA sequence
Length = 399
Score = 42.1 bits (21), Expect = 0.037
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 448 gaaccgctccggccggaactc 468
|||||||||||||||||||||
Sbjct: 395 gaaccgctccggccggaactc 375
>gb|CB881714.1|CB881714 HM10K16w HM Hordeum vulgare subsp. vulgare cDNA clone HM10K16
3-PRIME, mRNA sequence
Length = 542
Score = 42.1 bits (21), Expect = 0.037
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 370 gccggggcacacccggcggccggcgccgaacgg 402
||||||||||| || ||| ||||||||||||||
Sbjct: 485 gccggggcacatcctgcgcccggcgccgaacgg 517
>gb|BI955765.1|BI955765 HVSMEm0024G17f Hordeum vulgare green seedling EST library
HVcDNA0014 (Blumeria infected) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEm0024G17f, mRNA sequence
Length = 696
Score = 40.1 bits (20), Expect = 0.15
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 446 aggaaccgctccggccggaactcg 469
||||| ||||||||||||||||||
Sbjct: 340 aggaagcgctccggccggaactcg 317
>gb|BI960706.1|BI960706 HVSMEn0001B07f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0001B07f, mRNA sequence
Length = 1300
Score = 40.1 bits (20), Expect = 0.15
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 743 agcagctccgccatcgccca 762
||||||||||||||||||||
Sbjct: 217 agcagctccgccatcgccca 198
>gb|AV916579.1|AV916579 AV916579 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags17n10 5', mRNA sequence
Length = 563
Score = 40.1 bits (20), Expect = 0.15
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 734 gggttcctcagcagctccgccatcgccc 761
||||||| || |||||||||||||||||
Sbjct: 35 gggttccgcaacagctccgccatcgccc 8
>gb|AJ435273.1|AJ435273 AJ435273 S00002 Hordeum vulgare subsp. vulgare cDNA clone
S0000200083F08F1, mRNA sequence
Length = 538
Score = 40.1 bits (20), Expect = 0.15
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 446 aggaaccgctccggccggaactcg 469
||||| ||||||||||||||||||
Sbjct: 37 aggaagcgctccggccggaactcg 14
>gb|BQ758724.1|BQ758724 EBma07_SQ002_J15_R maternal, 21 DPA, no treatment, cv Optic, EBma07
Hordeum vulgare subsp. vulgare cDNA clone
EBma07_SQ002_J15 5', mRNA sequence
Length = 490
Score = 40.1 bits (20), Expect = 0.15
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 446 aggaaccgctccggccggaactcg 469
||||| ||||||||||||||||||
Sbjct: 206 aggaagcgctccggccggaactcg 183
>gb|CA009374.1|CA009374 HU13P05r HU Hordeum vulgare subsp. vulgare cDNA clone HU13P05
5-PRIME, mRNA sequence
Length = 537
Score = 40.1 bits (20), Expect = 0.15
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 371 ccggggcacacccggcggccggcgccgaacgg 402
||||||||||| || || ||||||||||||||
Sbjct: 296 ccggggcacacgcgccgcccggcgccgaacgg 265
Score = 40.1 bits (20), Expect = 0.15
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 601 cggcgggtgcaggcgcagggactccttgacga 632
||||||||||| |||||| | |||||||||||
Sbjct: 63 cggcgggtgcatgcgcagcgtctccttgacga 32
>gb|CA017497.1|CA017497 HV05G05r HV Hordeum vulgare subsp. vulgare cDNA clone HV05G05
5-PRIME, mRNA sequence
Length = 500
Score = 40.1 bits (20), Expect = 0.15
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 452 cgctccggccggaactcgag 471
||||||||||||||||||||
Sbjct: 97 cgctccggccggaactcgag 78
>gb|CA023650.1|CA023650 HZ46P09r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ46P09
5-PRIME, mRNA sequence
Length = 501
Score = 40.1 bits (20), Expect = 0.15
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 446 aggaaccgctccggccggaactcg 469
||||| ||||||||||||||||||
Sbjct: 132 aggaagcgctccggccggaactcg 109
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 177,313
Number of Sequences: 312970
Number of extensions: 177313
Number of successful extensions: 55381
Number of sequences better than 0.5: 48
Number of HSP's better than 0.5 without gapping: 48
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55274
Number of HSP's gapped (non-prelim): 93
length of query: 1067
length of database: 175,134,539
effective HSP length: 19
effective length of query: 1048
effective length of database: 169,188,109
effective search space: 177309138232
effective search space used: 177309138232
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)