BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2622915.2.1
(584 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CV064104.1|CV064104 BNEL98b1 Barley EST endosperm librar... 168 1e-040
gb|CA015797.1|CA015797 HV11O17u HV Hordeum vulgare subsp. v... 155 2e-036
gb|BU974893.1|BU974893 HB29G22r BC Hordeum vulgare subsp. v... 149 1e-034
gb|BU995027.1|BU995027 HM08P11r HM Hordeum vulgare subsp. v... 147 5e-034
gb|BU995276.1|BU995276 HM09L23r HM Hordeum vulgare subsp. v... 147 5e-034
gb|CB881163.1|CB881163 HM08P11w HM Hordeum vulgare subsp. v... 147 5e-034
gb|CB881416.1|CB881416 HM09L23w HM Hordeum vulgare subsp. v... 139 1e-031
gb|BM374601.1|BM374601 EBma05_SQ002_C03_R maternal, 12 DPA,... 101 2e-020
gb|BQ664756.1|BQ664756 HV04L17u HV Hordeum vulgare subsp. v... 100 1e-019
gb|BI780945.1|BI780945 EBma05_SQ001_J20_R maternal, 12 DPA,... 88 4e-016
gb|CA019419.1|CA019419 HV11O17r HV Hordeum vulgare subsp. v... 74 6e-012
gb|BU974803.1|BU974803 HB29C15r BC Hordeum vulgare subsp. v... 52 2e-005
gb|AV836507.1|AV836507 AV836507 K. Sato unpublished cDNA li... 40 0.079
gb|AV836924.1|AV836924 AV836924 K. Sato unpublished cDNA li... 40 0.079
gb|BU994439.1|BU994439 HM07B03r HM Hordeum vulgare subsp. v... 38 0.31
>gb|CV064104.1|CV064104 BNEL98b1 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL98b1 5' similar to putative
sterol 4-alpha-methyl-oxidase, mRNA sequence
Length = 640
Score = 168 bits (85), Expect = 1e-040
Identities = 156/180 (86%)
Strand = Plus / Plus
Query: 405 accagtccatgtaaacaaatgtcgaggcatagttccctgactttgtgtacagcactcggt 464
||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||| || |
Sbjct: 399 accagtccatgtaaacaaaagtagaggcgtagttccctgacttggtgtagagcacacgat 458
Query: 465 gatggtagtcatggaagtccgagccaccgtacaggggcaggaaatttgatgggctccatg 524
||||||||||||||||||| ||||| || ||||| |||||||| |||||||||||||| |
Sbjct: 459 gatggtagtcatggaagtcagagcctccatacagtggcaggaagtttgatgggctccaag 518
Query: 525 ggaagngatagccggtgtgagcttcaacagtcttcaatacccttaacaccatccacagcc 584
||||| |||| || |||||||||| || |||| || ||||| || |||||||||||||
Sbjct: 519 ggaagtgatatccactgtgagcttccaccgtctctaacaccctcaaaaccatccacagcc 578
>gb|CA015797.1|CA015797 HV11O17u HV Hordeum vulgare subsp. vulgare cDNA clone HV11O17
3-PRIME, mRNA sequence
Length = 536
Score = 155 bits (78), Expect = 2e-036
Identities = 128/145 (88%)
Strand = Plus / Plus
Query: 405 accagtccatgtaaacaaatgtcgaggcatagttccctgactttgtgtacagcactcggt 464
||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||| || |
Sbjct: 391 accagtccatgtaaacaaaagtagaggcgtagttccctgacttggtgtagagcacacgat 450
Query: 465 gatggtagtcatggaagtccgagccaccgtacaggggcaggaaatttgatgggctccatg 524
||||||||||||||||||| ||||| || ||||| |||||||| |||||||||||||| |
Sbjct: 451 gatggtagtcatggaagtcagagcctccatacagtggcaggaagtttgatgggctccaag 510
Query: 525 ggaagngatagccggtgtgagcttc 549
||||| |||| || ||||||||||
Sbjct: 511 ggaagtgatatccactgtgagcttc 535
>gb|BU974893.1|BU974893 HB29G22r BC Hordeum vulgare subsp. vulgare cDNA clone HB29G22
5-PRIME, mRNA sequence
Length = 499
Score = 149 bits (75), Expect = 1e-034
Identities = 116/130 (89%)
Strand = Plus / Minus
Query: 405 accagtccatgtaaacaaatgtcgaggcatagttccctgactttgtgtacagcactcggt 464
||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||| || |
Sbjct: 137 accagtccatgtaaacaaaagtagaggcgtagttccctgacttggtgtagagcacacgat 78
Query: 465 gatggtagtcatggaagtccgagccaccgtacaggggcaggaaatttgatgggctccatg 524
||||||||||||||||||| ||||| || ||||| |||||||| |||||||||||||| |
Sbjct: 77 gatggtagtcatggaagtcagagcctccatacagtggcaggaagtttgatgggctccaag 18
Query: 525 ggaagngata 534
||||| ||||
Sbjct: 17 ggaagtgata 8
>gb|BU995027.1|BU995027 HM08P11r HM Hordeum vulgare subsp. vulgare cDNA clone HM08P11
5-PRIME, mRNA sequence
Length = 621
Score = 147 bits (74), Expect = 5e-034
Identities = 156/183 (85%), Gaps = 3/183 (1%)
Strand = Plus / Minus
Query: 405 accagtccatgtaaacaaatgtcgaggcatagttccctgactttgtgtacagcactcggt 464
||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||| || |
Sbjct: 592 accagtccatgtaaacaaaagtagaggcgtagttccctgacttggtgtagagcacacgat 533
Query: 465 gatggtagtcatggaagtccga---gccaccgtacaggggcaggaaatttgatgggctcc 521
||||||||||||||||||| || ||| || ||||| |||||||| |||||||||||||
Sbjct: 532 gatggtagtcatggaagtcagagctgcctccatacagtggcaggaagtttgatgggctcc 473
Query: 522 atgggaagngatagccggtgtgagcttcaacagtcttcaatacccttaacaccatccaca 581
| |||||| |||| || |||||||||| || |||| || ||||| || ||||||||||
Sbjct: 472 aagggaagtgatatccactgtgagcttccaccgtctctaacaccctcaaaaccatccaca 413
Query: 582 gcc 584
|||
Sbjct: 412 gcc 410
>gb|BU995276.1|BU995276 HM09L23r HM Hordeum vulgare subsp. vulgare cDNA clone HM09L23
5-PRIME, mRNA sequence
Length = 591
Score = 147 bits (74), Expect = 5e-034
Identities = 156/183 (85%), Gaps = 3/183 (1%)
Strand = Plus / Minus
Query: 405 accagtccatgtaaacaaatgtcgaggcatagttccctgactttgtgtacagcactcggt 464
||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||| || |
Sbjct: 565 accagtccatgtaaacaaaagtagaggcgtagttccctgacttggtgtagagcacacgat 506
Query: 465 gatggtagtcatggaagtccga---gccaccgtacaggggcaggaaatttgatgggctcc 521
||||||||||||||||||| || ||| || ||||| |||||||| |||||||||||||
Sbjct: 505 gatggtagtcatggaagtcagagctgcctccatacagtggcaggaagtttgatgggctcc 446
Query: 522 atgggaagngatagccggtgtgagcttcaacagtcttcaatacccttaacaccatccaca 581
| |||||| |||| || |||||||||| || |||| || ||||| || ||||||||||
Sbjct: 445 aagggaagtgatatccactgtgagcttccaccgtctctaacaccctcaaaaccatccaca 386
Query: 582 gcc 584
|||
Sbjct: 385 gcc 383
>gb|CB881163.1|CB881163 HM08P11w HM Hordeum vulgare subsp. vulgare cDNA clone HM08P11
3-PRIME, mRNA sequence
Length = 604
Score = 147 bits (74), Expect = 5e-034
Identities = 156/183 (85%), Gaps = 3/183 (1%)
Strand = Plus / Plus
Query: 405 accagtccatgtaaacaaatgtcgaggcatagttccctgactttgtgtacagcactcggt 464
||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||| || |
Sbjct: 367 accagtccatgtaaacaaaagtagaggcgtagttccctgacttggtgtagagcacacgat 426
Query: 465 gatggtagtcatggaagtccga---gccaccgtacaggggcaggaaatttgatgggctcc 521
||||||||||||||||||| || ||| || ||||| |||||||| |||||||||||||
Sbjct: 427 gatggtagtcatggaagtcagagctgcctccatacagtggcaggaagtttgatgggctcc 486
Query: 522 atgggaagngatagccggtgtgagcttcaacagtcttcaatacccttaacaccatccaca 581
| |||||| |||| || |||||||||| || |||| || ||||| || ||||||||||
Sbjct: 487 aagggaagtgatatccactgtgagcttccaccgtctctaacaccctcaaaaccatccaca 546
Query: 582 gcc 584
|||
Sbjct: 547 gcc 549
>gb|CB881416.1|CB881416 HM09L23w HM Hordeum vulgare subsp. vulgare cDNA clone HM09L23
3-PRIME, mRNA sequence
Length = 576
Score = 139 bits (70), Expect = 1e-031
Identities = 155/183 (84%), Gaps = 3/183 (1%)
Strand = Plus / Plus
Query: 405 accagtccatgtaaacaaatgtcgaggcatagttccctgactttgtgtacagcactcggt 464
||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||| || |
Sbjct: 366 accagtccatgtaaacaaaagtagaggcgtagttccctgacttggtgtagagcacacgat 425
Query: 465 gatggtagtcatggaagtccga---gccaccgtacaggggcaggaaatttgatgggctcc 521
||||||||||||||||||| || ||| || ||||| |||||||| |||||||||||||
Sbjct: 426 gatggtagtcatggaagtcagagctgcctccatacagtggcaggaagtttgatgggctcc 485
Query: 522 atgggaagngatagccggtgtgagcttcaacagtcttcaatacccttaacaccatccaca 581
| |||||| |||| || |||||||||| || |||| || |||| | | ||||||||||
Sbjct: 486 aagggaagtgatatccactgtgagcttccaccgtctctaacacccctcaaaccatccaca 545
Query: 582 gcc 584
|||
Sbjct: 546 gcc 548
>gb|BM374601.1|BM374601 EBma05_SQ002_C03_R maternal, 12 DPA, no treatment, cv Optic, EBma05
Hordeum vulgare subsp. vulgare cDNA clone
EBma05_SQ002_C03 5', mRNA sequence
Length = 398
Score = 101 bits (51), Expect = 2e-020
Identities = 72/79 (91%)
Strand = Plus / Minus
Query: 405 accagtccatgtaaacaaatgtcgaggcatagttccctgactttgtgtacagcactcggt 464
||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||| || |
Sbjct: 79 accagtccatgtaaacaaaagtagaggcgtagttccctgacttggtgtagagcacacgat 20
Query: 465 gatggtagtcatggaagtc 483
|||||||||||||||||||
Sbjct: 19 gatggtagtcatggaagtc 1
>gb|BQ664756.1|BQ664756 HV04L17u HV Hordeum vulgare subsp. vulgare cDNA clone HV04L17
3-PRIME, mRNA sequence
Length = 615
Score = 99.6 bits (50), Expect = 1e-019
Identities = 71/78 (91%)
Strand = Plus / Plus
Query: 405 accagtccatgtaaacaaatgtcgaggcatagttccctgactttgtgtacagcactcggt 464
||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||| || |
Sbjct: 538 accagtccatgtaaacaaaagtagaggcgtagttccctgacttggtgtagagcacacgat 597
Query: 465 gatggtagtcatggaagt 482
||||||||||||||||||
Sbjct: 598 gatggtagtcatggaagt 615
>gb|BI780945.1|BI780945 EBma05_SQ001_J20_R maternal, 12 DPA, no treatment, cv Optic, EBma05
Hordeum vulgare subsp. vulgare cDNA clone
EBma05_SQ001_J20 5', mRNA sequence
Length = 398
Score = 87.7 bits (44), Expect = 4e-016
Identities = 65/72 (90%)
Strand = Plus / Minus
Query: 405 accagtccatgtaaacaaatgtcgaggcatagttccctgactttgtgtacagcactcggt 464
||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||| || |
Sbjct: 79 accagtccatgtaaacaaaagtagaggcgtagttccctgacttggtgtagagcacacgat 20
Query: 465 gatggtagtcat 476
||||||||||||
Sbjct: 19 gatggtagtcat 8
>gb|CA019419.1|CA019419 HV11O17r HV Hordeum vulgare subsp. vulgare cDNA clone HV11O17
5-PRIME, mRNA sequence
Length = 692
Score = 73.8 bits (37), Expect = 6e-012
Identities = 84/100 (84%)
Strand = Plus / Minus
Query: 485 gagccaccgtacaggggcaggaaatttgatgggctccatgggaagngatagccggtgtga 544
||||| || ||||| |||||||| |||||||||||||| |||||| |||| || |||||
Sbjct: 690 gagcctccatacagtggcaggaagtttgatgggctccaagggaagtgatatccactgtga 631
Query: 545 gcttcaacagtcttcaatacccttaacaccatccacagcc 584
||||| || |||| || ||||| || |||||||||||||
Sbjct: 630 gcttccaccgtctctaacaccctcaaaaccatccacagcc 591
>gb|BU974803.1|BU974803 HB29C15r BC Hordeum vulgare subsp. vulgare cDNA clone HB29C15
5-PRIME, mRNA sequence
Length = 493
Score = 52.0 bits (26), Expect = 2e-005
Identities = 61/73 (83%)
Strand = Plus / Minus
Query: 512 gatgggctccatgggaagngatagccggtgtgagcttcaacagtcttcaatacccttaac 571
||||||||||| |||||| |||| || |||||||||| || |||| || ||||| ||
Sbjct: 493 gatgggctccaagggaagtgatatccactgtgagcttccaccgtctctaacaccctcaaa 434
Query: 572 accatccacagcc 584
|||||||||||||
Sbjct: 433 accatccacagcc 421
>gb|AV836507.1|AV836507 AV836507 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
vulgare seedling leaves second leaf stage Hordeum
vulgare subsp. vulgare cDNA clone basd22h22, mRNA
sequence
Length = 700
Score = 40.1 bits (20), Expect = 0.079
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 262 ttcttcttcttcacttcttgctcc 285
||||||||||||||||||| ||||
Sbjct: 23 ttcttcttcttcacttcttcctcc 46
>gb|AV836924.1|AV836924 AV836924 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
vulgare seedling leaves second leaf stage Hordeum
vulgare subsp. vulgare cDNA clone basd14a23, mRNA
sequence
Length = 729
Score = 40.1 bits (20), Expect = 0.079
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 254 tttacagattcttcttcttc 273
||||||||||||||||||||
Sbjct: 283 tttacagattcttcttcttc 264
>gb|BU994439.1|BU994439 HM07B03r HM Hordeum vulgare subsp. vulgare cDNA clone HM07B03
5-PRIME, mRNA sequence
Length = 444
Score = 38.2 bits (19), Expect = 0.31
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 262 ttcttcttcttcacttctt 280
|||||||||||||||||||
Sbjct: 46 ttcttcttcttcacttctt 64
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 59,063
Number of Sequences: 312970
Number of extensions: 59063
Number of successful extensions: 19254
Number of sequences better than 0.5: 15
Number of HSP's better than 0.5 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19225
Number of HSP's gapped (non-prelim): 25
length of query: 584
length of database: 175,134,539
effective HSP length: 19
effective length of query: 565
effective length of database: 169,188,109
effective search space: 95591281585
effective search space used: 95591281585
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)