BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2621801.2.1
(679 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE194107.2|BE194107 HVSMEh0084A24f Hordeum vulgare 5-45 ... 82 3e-014
gb|BF267540.2|BF267540 HV_CEa0018D16f Hordeum vulgare seedl... 82 3e-014
gb|AV921807.1|AV921807 AV921807 K. Sato unpublished cDNA li... 82 3e-014
gb|AV931272.1|AV931272 AV931272 K. Sato unpublished cDNA li... 82 3e-014
gb|BM815988.1|BM815988 HC108H09_SK.ab1 HC Hordeum vulgare s... 82 3e-014
gb|BQ656750.1|BQ656750 HA02F05u HA Hordeum vulgare subsp. v... 82 3e-014
gb|BU972798.1|BU972798 HB22L24r BC Hordeum vulgare subsp. v... 82 3e-014
gb|CA018967.1|CA018967 HV10E09r HV Hordeum vulgare subsp. v... 82 3e-014
gb|CA027624.1|CA027624 HZ59I04r HZ Hordeum vulgare subsp. v... 82 3e-014
gb|BJ544355.1|BJ544355 BJ544355 K. Sato unpublished cDNA li... 82 3e-014
gb|BJ544525.1|BJ544525 BJ544525 K. Sato unpublished cDNA li... 82 3e-014
gb|BJ545493.1|BJ545493 BJ545493 K. Sato unpublished cDNA li... 82 3e-014
gb|BJ545810.1|BJ545810 BJ545810 K. Sato unpublished cDNA li... 82 3e-014
gb|BJ545985.1|BJ545985 BJ545985 K. Sato unpublished cDNA li... 82 3e-014
gb|BJ546487.1|BJ546487 BJ546487 K. Sato unpublished cDNA li... 82 3e-014
gb|BJ546503.1|BJ546503 BJ546503 K. Sato unpublished cDNA li... 82 3e-014
gb|BJ548158.1|BJ548158 BJ548158 K. Sato unpublished cDNA li... 82 3e-014
gb|BJ548794.1|BJ548794 BJ548794 K. Sato unpublished cDNA li... 82 3e-014
gb|BJ549890.1|BJ549890 BJ549890 K. Sato unpublished cDNA li... 82 3e-014
dbj|AB055519.1| Hordeum vulgare mRNA for mitochondrial alde... 82 3e-014
gb|BI776695.2|BI776695 EBpi07_SQ001_H11_R pistil, 12 DPA, n... 74 7e-012
gb|BF267588.2|BF267588 HV_CEa0018F16f Hordeum vulgare seedl... 72 3e-011
gb|BQ463802.1|BQ463802 HG01H17r HG Hordeum vulgare subsp. v... 72 3e-011
gb|BQ659983.1|BQ659983 HG01H17u HG Hordeum vulgare subsp. v... 72 3e-011
gb|CD663937.1|CD663937 UCRHV18_07af09_b1 Drought-stressed D... 72 3e-011
gb|CA016131.1|CA016131 HV10E09u HV Hordeum vulgare subsp. v... 68 4e-010
gb|AW983019.2|AW983019 HVSMEg0004N09f Hordeum vulgare pre-a... 64 6e-009
gb|BI949913.1|BI949913 HVSMEl0016O20f Hordeum vulgare spike... 62 3e-008
gb|BG300455.1|BG300455 HVSMEb0017B23f Hordeum vulgare seedl... 58 4e-007
gb|BF266942.2|BF266942 HV_CEa0016I01f Hordeum vulgare seedl... 56 2e-006
gb|BJ545003.1|BJ545003 BJ545003 K. Sato unpublished cDNA li... 56 2e-006
gb|BJ545021.1|BJ545021 BJ545021 K. Sato unpublished cDNA li... 56 2e-006
gb|BJ447724.1|BJ447724 BJ447724 K. Sato unpublished cDNA li... 52 2e-005
gb|AV917894.1|AV917894 AV917894 K. Sato unpublished cDNA li... 50 1e-004
gb|AV929175.1|AV929175 AV929175 K. Sato unpublished cDNA li... 50 1e-004
gb|BJ448569.1|BJ448569 BJ448569 K. Sato unpublished cDNA li... 50 1e-004
gb|BJ456291.1|BJ456291 BJ456291 K. Sato unpublished cDNA li... 50 1e-004
gb|BQ464230.1|BQ464230 HF01L06T HF Hordeum vulgare subsp. v... 50 1e-004
gb|BQ466268.1|BQ466268 HT02B02r HT Hordeum vulgare subsp. v... 50 1e-004
gb|BQ659782.1|BQ659782 HF01L06w HF Hordeum vulgare subsp. v... 50 1e-004
gb|BQ761582.1|BQ761582 EBem10_SQ001_N02_R embryo, 2 Day ger... 50 1e-004
gb|BU981973.1|BU981973 HA25C12r HA Hordeum vulgare subsp. v... 50 1e-004
gb|BU984313.1|BU984313 HF03J09r HF Hordeum vulgare subsp. v... 50 1e-004
gb|CA000617.1|CA000617 HS07N10u HS Hordeum vulgare subsp. v... 50 1e-004
gb|CA009784.1|CA009784 HT12M08u HT Hordeum vulgare subsp. v... 50 1e-004
gb|CA015545.1|CA015545 HT14K09r HT Hordeum vulgare subsp. v... 50 1e-004
gb|CA021407.1|CA021407 HZ40A05r HZ Hordeum vulgare subsp. v... 50 1e-004
gb|AL501734.1|AL501734 AL501734 Hordeum vulgare Barke roots... 48 4e-004
gb|BM371235.1|BM371235 EBro04_SQ003_O18_R root, 3 week, sal... 48 4e-004
gb|CB877540.1|CB877540 HP05E21T HP Hordeum vulgare subsp. v... 48 4e-004
gb|BE060168.2|BE060168 HVSMEg0011C03f Hordeum vulgare pre-a... 46 0.001
gb|BI948988.1|BI948988 HVSMEl0011N01f Hordeum vulgare spike... 42 0.023
gb|CV060332.1|CV060332 BNEL57a10 Barley EST endosperm libra... 42 0.023
gb|BM100755.2|BM100755 EBpi01_SQ001_J05_R pistil, 1 DPA, no... 40 0.092
gb|BF260384.2|BF260384 HVSMEf0021N16f Hordeum vulgare seedl... 38 0.36
gb|BF260792.2|BF260792 HVSMEf0022P08f Hordeum vulgare seedl... 38 0.36
gb|BE454066.2|BE454066 HVSMEh0080C02f Hordeum vulgare 5-45 ... 38 0.36
gb|BI947518.1|BI947518 HVSMEl0005M01f Hordeum vulgare spike... 38 0.36
gb|BI947781.1|BI947781 HVSMEl0006O16f Hordeum vulgare spike... 38 0.36
gb|BE196308.3|BE196308 HVSMEh0091P05f Hordeum vulgare 5-45 ... 38 0.36
gb|CA023114.1|CA023114 HZ45E11r HZ Hordeum vulgare subsp. v... 38 0.36
gb|CA024921.1|CA024921 HZ50L08r HZ Hordeum vulgare subsp. v... 38 0.36
gb|CA025088.1|CA025088 HZ51C22r HZ Hordeum vulgare subsp. v... 38 0.36
gb|CA028973.1|CA028973 HZ63M16r HZ Hordeum vulgare subsp. v... 38 0.36
gb|CA029209.1|CA029209 HZ64I15r HZ Hordeum vulgare subsp. v... 38 0.36
gb|CA029357.1|CA029357 HZ64P16r HZ Hordeum vulgare subsp. v... 38 0.36
>gb|BE194107.2|BE194107 HVSMEh0084A24f Hordeum vulgare 5-45 DAP spike EST library
HVcDNA0009 (5 to 45 DAP) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEh0084A24f, mRNA sequence
Length = 628
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 238 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 179
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 178 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 119
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 118 ggccgtgtccagg 106
>gb|BF267540.2|BF267540 HV_CEa0018D16f Hordeum vulgare seedling green leaf EST library
HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEa0018D16f, mRNA sequence
Length = 803
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 491 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 432
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 431 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 372
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 371 ggccgtgtccagg 359
Score = 56.0 bits (28), Expect = 2e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 154 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctca 95
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 94 tcatcaatctgaggaccctg 75
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 262 ggcccgaatatctcctcctgggctatcttcat 231
>gb|AV921807.1|AV921807 AV921807 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags12o18 3', mRNA sequence
Length = 657
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 309 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 368
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 369 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 428
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 429 ggccgtgtccagg 441
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 538 ggcccgaatatctcctcctgggctatcttcat 569
>gb|AV931272.1|AV931272 AV931272 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd19d07 3', mRNA sequence
Length = 556
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 277 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 336
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 337 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 396
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 397 ggccgtgtccagg 409
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 506 ggcccgaatatctcctcctgggctatcttcat 537
>gb|BM815988.1|BM815988 HC108H09_SK.ab1 HC Hordeum vulgare subsp. vulgare cDNA clone
HC108H09_SK.ab1 similar to aldehyde dehydrogenase [Oryza
sativa], T-cytoplasm male sterility restorer factor 2
[Zea mays],aldehyde dehydrogenase (NAD) (EC 1.2.1.3) 2A
precursor, mitochondrial [Nicotiana tabacum],aldehyde
dehydrogenase ALDH2b [Oryza sativa], mRNA sequence
Length = 896
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 440 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 381
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 380 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 321
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 320 ggccgtgtccagg 308
Score = 54.0 bits (27), Expect = 6e-006
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctc 563
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 103 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctc 45
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 211 ggcccgaatatctcctcctgggctatcttcat 180
>gb|BQ656750.1|BQ656750 HA02F05u HA Hordeum vulgare subsp. vulgare cDNA clone HA02F05
3-PRIME, mRNA sequence
Length = 549
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 316 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 375
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 376 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 435
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 436 ggccgtgtccagg 448
>gb|BU972798.1|BU972798 HB22L24r BC Hordeum vulgare subsp. vulgare cDNA clone HB22L24
5-PRIME, mRNA sequence
Length = 629
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 426 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 367
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 366 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 307
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 306 ggccgtgtccagg 294
Score = 54.0 bits (27), Expect = 6e-006
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctc 563
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 89 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctc 31
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 197 ggcccgaatatctcctcctgggctatcttcat 166
>gb|CA018967.1|CA018967 HV10E09r HV Hordeum vulgare subsp. vulgare cDNA clone HV10E09
5-PRIME, mRNA sequence
Length = 298
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 252 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 193
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 192 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 133
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 132 ggccgtgtccagg 120
>gb|CA027624.1|CA027624 HZ59I04r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ59I04
5-PRIME, mRNA sequence
Length = 374
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 141 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 200
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 201 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 260
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 261 ggccgtgtccagg 273
>gb|BJ544355.1|BJ544355 BJ544355 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak26h06 5', mRNA sequence
Length = 638
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 564 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 505
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 504 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 445
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 444 ggccgtgtccagg 432
Score = 56.0 bits (28), Expect = 2e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 227 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctca 168
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 167 tcatcaatctgaggaccctg 148
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 335 ggcccgaatatctcctcctgggctatcttcat 304
>gb|BJ544525.1|BJ544525 BJ544525 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak30h11 5', mRNA sequence
Length = 696
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 576 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 517
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 516 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 457
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 456 ggccgtgtccagg 444
Score = 56.0 bits (28), Expect = 2e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 239 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctca 180
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 179 tcatcaatctgaggaccctg 160
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 347 ggcccgaatatctcctcctgggctatcttcat 316
>gb|BJ545493.1|BJ545493 BJ545493 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak17a20 3', mRNA sequence
Length = 586
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 324 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 383
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 384 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 443
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 444 ggccgtgtccagg 456
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 553 ggcccgaatatctcctcctgggctatcttcat 584
>gb|BJ545810.1|BJ545810 BJ545810 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak26h06 3', mRNA sequence
Length = 672
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 324 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 383
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 384 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 443
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 444 ggccgtgtccagg 456
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 553 ggcccgaatatctcctcctgggctatcttcat 584
>gb|BJ545985.1|BJ545985 BJ545985 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak30h11 3', mRNA sequence
Length = 624
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 296 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 355
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 356 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 415
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 416 ggccgtgtccagg 428
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 525 ggcccgaatatctcctcctgggctatcttcat 556
>gb|BJ546487.1|BJ546487 BJ546487 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak42a08 3', mRNA sequence
Length = 557
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 326 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 385
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 386 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 445
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 446 ggccgtgtccagg 458
>gb|BJ546503.1|BJ546503 BJ546503 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak42e14 3', mRNA sequence
Length = 530
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 300 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 359
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 360 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 419
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 420 ggccgtgtccagg 432
>gb|BJ548158.1|BJ548158 BJ548158 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal13d19 3', mRNA sequence
Length = 620
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 299 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 358
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 359 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 418
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 419 ggccgtgtccagg 431
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 528 ggcccgaatatctcctcctgggctatcttcat 559
>gb|BJ548794.1|BJ548794 BJ548794 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal35m14 3', mRNA sequence
Length = 581
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 290 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 349
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 350 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 409
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 410 ggccgtgtccagg 422
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 519 ggcccgaatatctcctcctgggctatcttcat 550
>gb|BJ549890.1|BJ549890 BJ549890 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags35f16 3', mRNA sequence
Length = 480
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 309 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 368
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 369 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 428
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 429 ggccgtgtccagg 441
>dbj|AB055519.1| Hordeum vulgare mRNA for mitochondrial aldehyde dehydrogenase ALDH2,
complete cds
Length = 2128
Score = 81.8 bits (41), Expect = 3e-014
Identities = 110/133 (82%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 1662 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 1603
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| |||| || || |||| || ||||||
Sbjct: 1602 gaagatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgtt 1543
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 1542 ggccgtgtccagg 1530
Score = 56.0 bits (28), Expect = 2e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 1325 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctca 1266
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 1265 tcatcaatctgaggaccctg 1246
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 1433 ggcccgaatatctcctcctgggctatcttcat 1402
>gb|BI776695.2|BI776695 EBpi07_SQ001_H11_R pistil, 12 DPA, no treatment, cv Optic, EBpi07
Hordeum vulgare subsp. vulgare cDNA clone
EBpi07_SQ001_H11 5', mRNA sequence
Length = 481
Score = 73.8 bits (37), Expect = 7e-012
Identities = 109/133 (81%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 382 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 323
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| ||| || || |||| || ||||||
Sbjct: 322 gaagatgtcaaagcagttcacccagatcgtgccggccttgagggcacgcgtcaaggtgtt 263
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 262 ggccgtgtccagg 250
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 153 ggcccgaatatctcctcctgggctatcttcat 122
>gb|BF267588.2|BF267588 HV_CEa0018F16f Hordeum vulgare seedling green leaf EST library
HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEa0018F16f, mRNA sequence
Length = 808
Score = 71.9 bits (36), Expect = 3e-011
Identities = 72/84 (85%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 491 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 432
Query: 228 gaacacgtcgtagcagttcaccca 251
||| | ||| |||||||||||||
Sbjct: 431 gaagatgtcaaagcagttcaccca 408
Score = 56.0 bits (28), Expect = 2e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 153 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctca 94
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 93 tcatcaatctgaggaccctg 74
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 261 ggcccgaatatctcctcctgggctatcttcat 230
>gb|BQ463802.1|BQ463802 HG01H17r HG Hordeum vulgare subsp. vulgare cDNA clone HG01H17
5-PRIME, mRNA sequence
Length = 462
Score = 71.9 bits (36), Expect = 3e-011
Identities = 72/84 (85%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 342 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 401
Query: 228 gaacacgtcgtagcagttcaccca 251
||| | ||| |||||||||||||
Sbjct: 402 gaagatgtcaaagcagttcaccca 425
>gb|BQ659983.1|BQ659983 HG01H17u HG Hordeum vulgare subsp. vulgare cDNA clone HG01H17
3-PRIME, mRNA sequence
Length = 461
Score = 71.9 bits (36), Expect = 3e-011
Identities = 72/84 (85%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 120 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 61
Query: 228 gaacacgtcgtagcagttcaccca 251
||| | ||| |||||||||||||
Sbjct: 60 gaagatgtcaaagcagttcaccca 37
>gb|CD663937.1|CD663937 UCRHV18_07af09_b1 Drought-stressed Dicktoo barley epidermis cDNA
library Hordeum vulgare subsp. vulgare cDNA clone
UCRHV18_07af09, mRNA sequence
Length = 372
Score = 71.9 bits (36), Expect = 3e-011
Identities = 72/84 (85%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 287 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 346
Query: 228 gaacacgtcgtagcagttcaccca 251
||| | ||| |||||||||||||
Sbjct: 347 gaagatgtcaaagcagttcaccca 370
>gb|CA016131.1|CA016131 HV10E09u HV Hordeum vulgare subsp. vulgare cDNA clone HV10E09
3-PRIME, mRNA sequence
Length = 488
Score = 67.9 bits (34), Expect = 4e-010
Identities = 70/82 (85%)
Strand = Plus / Plus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 407 gatgcccttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 466
Query: 228 gaacacgtcgtagcagttcacc 249
||| | ||| |||||||||||
Sbjct: 467 gaagatgtcaaagcagttcacc 488
>gb|AW983019.2|AW983019 HVSMEg0004N09f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0004N09f, mRNA sequence
Length = 614
Score = 63.9 bits (32), Expect = 6e-009
Identities = 71/84 (84%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||| ||||||| |||| ||||||||||||||| |||||||| ||||| | ||| ||
Sbjct: 324 gatgcctttctccctaccgatgccgctcatcttgtacccgccgaaggggatcgcggcatc 265
Query: 228 gaacacgtcgtagcagttcaccca 251
||| | ||| |||||||||||||
Sbjct: 264 gaagatgtcaaagcagttcaccca 241
>gb|BI949913.1|BI949913 HVSMEl0016O20f Hordeum vulgare spike EST library HVcDNA0012
(Fusarium infected) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEl0016O20f, mRNA sequence
Length = 440
Score = 61.9 bits (31), Expect = 3e-008
Identities = 106/131 (80%)
Strand = Plus / Minus
Query: 170 tgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtcga 229
||||||| |||| |||| |||| |||||||||| |||||||| ||||| | ||| | ||
Sbjct: 405 tgcccttatccctaccgatgccgatcatcttgtacccgccgaaggggatcgcggcattga 346
Query: 230 acacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgttgg 289
||| ||| ||||||||||||| | ||||| |||| || || |||| || ||||||||
Sbjct: 345 acatgtcaaagcagttcacccagatcgtgccggccctgagggcacgcgtcaaggtgttgg 286
Query: 290 ccgcgtccagg 300
||| |||||||
Sbjct: 285 ccgtgtccagg 275
Score = 54.0 bits (27), Expect = 6e-006
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctc 563
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 70 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctc 12
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 178 ggcccgaatatctcctcctgggctatcttcat 147
>gb|BG300455.1|BG300455 HVSMEb0017B23f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0017B23f, mRNA sequence
Length = 853
Score = 58.0 bits (29), Expect = 4e-007
Identities = 107/133 (80%)
Strand = Plus / Minus
Query: 168 gatgcccttctcccgcccgacgccgctcatcttgtagccgccgaacgggatggtggcgtc 227
|||||||||||||| |||| |||||||||||||| |||||||| ||||| | ||| |
Sbjct: 257 gatgcccttctccctaccgagtccgctcatcttgtacccgccgaaggggatcgcggcatt 198
Query: 228 gaacacgtcgtagcagttcacccacacggtgcccgcccgcagcgcccgcgacagggtgtt 287
||| | ||| ||||||||||||| | ||||| ||| || || |||| || ||||||
Sbjct: 197 gaagatgtcaaagcagttcacccagatcgtgccggcctttagggcacgcgtcaaggtgtt 138
Query: 288 ggccgcgtccagg 300
||||| |||||||
Sbjct: 137 ggccgtgtccagg 125
>gb|BF266942.2|BF266942 HV_CEa0016I01f Hordeum vulgare seedling green leaf EST library
HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEa0016I01f, mRNA sequence
Length = 837
Score = 56.0 bits (28), Expect = 2e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 385 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctca 326
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 325 tcatcaatctgaggaccctg 306
Score = 40.1 bits (20), Expect = 0.092
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 397 ggcccgaatatctcctcccgagcgatcttcat 428
|||||||||||||||||| | || ||||||||
Sbjct: 493 ggcccgaatatctcctcctgggctatcttcat 462
>gb|BJ545003.1|BJ545003 BJ545003 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak42a08 5', mRNA sequence
Length = 631
Score = 56.0 bits (28), Expect = 2e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 603 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctca 544
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 543 tcatcaatctgaggaccctg 524
>gb|BJ545021.1|BJ545021 BJ545021 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak42e14 5', mRNA sequence
Length = 632
Score = 56.0 bits (28), Expect = 2e-006
Identities = 67/80 (83%)
Strand = Plus / Minus
Query: 505 agggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcg 564
|||||||| || |||||||| || |||| || ||| ||||||||||| |||||||||||
Sbjct: 617 agggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctca 558
Query: 565 ccgtcgatctgaggcccctg 584
| || |||||||| |||||
Sbjct: 557 tcatcaatctgaggaccctg 538
>gb|BJ447724.1|BJ447724 BJ447724 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak17a20 5', mRNA sequence
Length = 533
Score = 52.0 bits (26), Expect = 2e-005
Identities = 65/78 (83%)
Strand = Plus / Minus
Query: 507 ggtggcaccgctgtcgacgccggactgaacgtaccgcaagatcttgttgaattgctcgcc 566
|||||| || |||||||| || |||| || ||| ||||||||||| ||||||||||| |
Sbjct: 533 ggtggctccactgtcgacacccgacttaatgtagcgcaagatcttcttgaattgctcatc 474
Query: 567 gtcgatctgaggcccctg 584
|| |||||||| |||||
Sbjct: 473 atcaatctgaggaccctg 456
>gb|AV917894.1|AV917894 AV917894 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags11p17 3', mRNA sequence
Length = 614
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 153 ccgaagccgctcatcttgcagccgccgaacggg 185
>gb|AV929175.1|AV929175 AV929175 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd11e16 3', mRNA sequence
Length = 636
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 210 ccgaagccgctcatcttgcagccgccgaacggg 242
>gb|BJ448569.1|BJ448569 BJ448569 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak20g24 5', mRNA sequence
Length = 670
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 555 ccgaagccgctcatcttgcagccgccgaacggg 523
>gb|BJ456291.1|BJ456291 BJ456291 K. Sato unpublished cDNA library, cv. Akashinriki
vegetative stage leaves Hordeum vulgare subsp. vulgare
cDNA clone baak20g24 3', mRNA sequence
Length = 706
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 151 ccgaagccgctcatcttgcagccgccgaacggg 183
>gb|BQ464230.1|BQ464230 HF01L06T HF Hordeum vulgare subsp. vulgare cDNA clone HF01L06
5-PRIME, mRNA sequence
Length = 511
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 313 ccgaagccgctcatcttgcagccgccgaacggg 281
>gb|BQ466268.1|BQ466268 HT02B02r HT Hordeum vulgare subsp. vulgare cDNA clone HT02B02
5-PRIME, mRNA sequence
Length = 438
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 192 ccgaagccgctcatcttgcagccgccgaacggg 224
>gb|BQ659782.1|BQ659782 HF01L06w HF Hordeum vulgare subsp. vulgare cDNA clone HF01L06
3-PRIME, mRNA sequence
Length = 475
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 200 ccgaagccgctcatcttgcagccgccgaacggg 232
>gb|BQ761582.1|BQ761582 EBem10_SQ001_N02_R embryo, 2 Day germination, no treatment, cv
Optic, EBem10 Hordeum vulgare subsp. vulgare cDNA clone
EBem10_SQ001_N02 5', mRNA sequence
Length = 347
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 49 ccgaagccgctcatcttgcagccgccgaacggg 81
>gb|BU981973.1|BU981973 HA25C12r HA Hordeum vulgare subsp. vulgare cDNA clone HA25C12
5-PRIME, mRNA sequence
Length = 572
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 383 ccgaagccgctcatcttgcagccgccgaacggg 351
>gb|BU984313.1|BU984313 HF03J09r HF Hordeum vulgare subsp. vulgare cDNA clone HF03J09
5-PRIME, mRNA sequence
Length = 526
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 484 ccgaagccgctcatcttgcagccgccgaacggg 452
>gb|CA000617.1|CA000617 HS07N10u HS Hordeum vulgare subsp. vulgare cDNA clone HS07N10
3-PRIME, mRNA sequence
Length = 574
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 150 ccgaagccgctcatcttgcagccgccgaacggg 182
>gb|CA009784.1|CA009784 HT12M08u HT Hordeum vulgare subsp. vulgare cDNA clone HT12M08
3-PRIME, mRNA sequence
Length = 532
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 218 ccgaagccgctcatcttgcagccgccgaacggg 250
>gb|CA015545.1|CA015545 HT14K09r HT Hordeum vulgare subsp. vulgare cDNA clone HT14K09
5-PRIME, mRNA sequence
Length = 584
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 367 ccgaagccgctcatcttgcagccgccgaacggg 335
>gb|CA021407.1|CA021407 HZ40A05r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ40A05
5-PRIME, mRNA sequence
Length = 530
Score = 50.1 bits (25), Expect = 1e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 184 ccgacgccgctcatcttgtagccgccgaacggg 216
|||| ||||||||||||| ||||||||||||||
Sbjct: 200 ccgaagccgctcatcttgcagccgccgaacggg 232
>gb|AL501734.1|AL501734 AL501734 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW05C24u 3', mRNA sequence
Length = 556
Score = 48.1 bits (24), Expect = 4e-004
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaa 212
||||||| ||||| |||| ||||||||||||||| ||||||||
Sbjct: 306 atgccctggtcccggccgaagccgctcatcttgtacccgccgaa 349
Score = 38.2 bits (19), Expect = 0.36
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 237 gtagcagttcacccacacggtgcccgc 263
|||||||||||||||||| || |||||
Sbjct: 374 gtagcagttcacccacactgtccccgc 400
>gb|BM371235.1|BM371235 EBro04_SQ003_O18_R root, 3 week, salt-stressed, cv Optic, EBro04
Hordeum vulgare subsp. vulgare cDNA clone
EBro04_SQ003_O18 5', mRNA sequence
Length = 423
Score = 48.1 bits (24), Expect = 4e-004
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaa 212
||||||| ||||| |||| ||||||||||||||| ||||||||
Sbjct: 205 atgccctggtcccggccgaagccgctcatcttgtacccgccgaa 162
Score = 38.2 bits (19), Expect = 0.36
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 237 gtagcagttcacccacacggtgcccgc 263
|||||||||||||||||| || |||||
Sbjct: 137 gtagcagttcacccacactgtccccgc 111
>gb|CB877540.1|CB877540 HP05E21T HP Hordeum vulgare subsp. vulgare cDNA clone HP05E21
5-PRIME, mRNA sequence
Length = 373
Score = 48.1 bits (24), Expect = 4e-004
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 169 atgcccttctcccgcccgacgccgctcatcttgtagccgccgaa 212
||||||| ||||| |||| ||||||||||||||| ||||||||
Sbjct: 191 atgccctggtcccggccgaagccgctcatcttgtacccgccgaa 148
Score = 38.2 bits (19), Expect = 0.36
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 237 gtagcagttcacccacacggtgcccgc 263
|||||||||||||||||| || |||||
Sbjct: 123 gtagcagttcacccacactgtccccgc 97
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 110,044
Number of Sequences: 312970
Number of extensions: 110044
Number of successful extensions: 31022
Number of sequences better than 0.5: 66
Number of HSP's better than 0.5 without gapping: 66
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30888
Number of HSP's gapped (non-prelim): 131
length of query: 679
length of database: 175,134,539
effective HSP length: 19
effective length of query: 660
effective length of database: 169,188,109
effective search space: 111664151940
effective search space used: 111664151940
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)