BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2418946.2.1
(690 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CB883678.1|CB883678 HQ02P09w HQ Hordeum vulgare subsp. v... 155 2e-036
gb|BQ754043.1|BQ754043 EBca01_SQ002_K10_R carpel, pre-anthe... 149 1e-034
gb|AV927733.1|AV927733 AV927733 K. Sato unpublished cDNA li... 117 5e-025
gb|AV931607.1|AV931607 AV931607 K. Sato unpublished cDNA li... 117 5e-025
gb|AV931716.1|AV931716 AV931716 K. Sato unpublished cDNA li... 117 5e-025
gb|AV934689.1|AV934689 AV934689 K. Sato unpublished cDNA li... 117 5e-025
gb|AV936387.1|AV936387 AV936387 K. Sato unpublished cDNA li... 117 5e-025
gb|BJ473617.1|BJ473617 BJ473617 K. Sato unpublished cDNA li... 117 5e-025
gb|BJ475011.1|BJ475011 BJ475011 K. Sato unpublished cDNA li... 117 5e-025
gb|BJ477252.1|BJ477252 BJ477252 K. Sato unpublished cDNA li... 117 5e-025
gb|BQ661605.1|BQ661605 HM04E05u HM Hordeum vulgare subsp. v... 117 5e-025
gb|CD663693.1|CD663693 UCRHV18_06bd04_b1 Drought-stressed D... 117 5e-025
gb|CD663695.1|CD663695 UCRHV18_06bd07_b1 Drought-stressed D... 109 1e-022
gb|AV931608.1|AV931608 AV931608 K. Sato unpublished cDNA li... 107 5e-022
gb|BJ469981.1|BJ469981 BJ469981 K. Sato unpublished cDNA li... 103 8e-021
gb|BJ472233.1|BJ472233 BJ472233 K. Sato unpublished cDNA li... 103 8e-021
gb|BJ473277.1|BJ473277 BJ473277 K. Sato unpublished cDNA li... 103 8e-021
gb|BJ474020.1|BJ474020 BJ474020 K. Sato unpublished cDNA li... 103 8e-021
gb|BJ474554.1|BJ474554 BJ474554 K. Sato unpublished cDNA li... 103 8e-021
gb|BJ476230.1|BJ476230 BJ476230 K. Sato unpublished cDNA li... 103 8e-021
gb|BJ471422.1|BJ471422 BJ471422 K. Sato unpublished cDNA li... 94 7e-018
gb|BJ477461.1|BJ477461 BJ477461 K. Sato unpublished cDNA li... 90 1e-016
gb|BM377017.2|BM377017 EBem05_SQ003_O02_R embryo, 14 DPA, n... 88 4e-016
gb|BM374568.2|BM374568 EBpi03_SQ003_P19_R pistil, 4 DPA, no... 82 3e-014
gb|BU972175.1|BU972175 HB20N14r BC Hordeum vulgare subsp. v... 82 3e-014
gb|BF265457.3|BF265457 HV_CEa0012F07f Hordeum vulgare seedl... 78 4e-013
gb|BG418430.1|BG418430 HVSMEk0022K21f Hordeum vulgare testa... 50 1e-004
gb|AV926707.1|AV926707 AV926707 K. Sato unpublished cDNA li... 50 1e-004
gb|AV926824.1|AV926824 AV926824 K. Sato unpublished cDNA li... 50 1e-004
gb|BM101006.1|BM101006 EBpi01_SQ002_J05_R pistil, 1 DPA, no... 48 4e-004
gb|BU995906.1|BU995906 HM11L21r HM Hordeum vulgare subsp. v... 48 4e-004
gb|CB882058.1|CB882058 HM11L21w HM Hordeum vulgare subsp. v... 48 4e-004
gb|CD662722.1|CD662722 UCRHV18_02df07_b1 Drought-stressed D... 48 4e-004
gb|AV837078.1|AV837078 AV837078 K. Sato unpublished cDNA li... 46 0.002
gb|BG415664.1|BG415664 HVSMEk0007G03f Hordeum vulgare testa... 46 0.002
gb|BG417338.1|BG417338 HVSMEk0017J08f Hordeum vulgare testa... 46 0.002
gb|BG418775.1|BG418775 HVSMEk0024G07f Hordeum vulgare testa... 46 0.002
gb|AJ461988.1|AJ461988 AJ461988 S00002 Hordeum vulgare subs... 46 0.002
gb|BJ474560.1|BJ474560 BJ474560 K. Sato unpublished cDNA li... 46 0.002
gb|CA018258.1|CA018258 HV08B15r HV Hordeum vulgare subsp. v... 46 0.002
gb|CB876259.1|CB876259 HX10M03w HX Hordeum vulgare subsp. v... 46 0.002
gb|AY177665.1| Hordeum vulgare subsp. vulgare putative call... 46 0.002
gb|CD663772.1|CD663772 UCRHV18_06cd06_b1 Drought-stressed D... 44 0.006
gb|BE216855.1|BE216855 HV_CEb0011N08f Hordeum vulgare seedl... 40 0.094
gb|BE437255.1|BE437255 SFR003.A06F990621 ITEC SFR Barley Le... 38 0.37
gb|AL499895.1|AL499895 AL499895 Hordeum vulgare Barke etiol... 38 0.37
gb|AL500177.1|AL500177 AL500177 Hordeum vulgare Barke etiol... 38 0.37
gb|AL502723.1|AL502723 AL502723 Hordeum vulgare Barke roots... 38 0.37
gb|AL503065.1|AL503065 AL503065 Hordeum vulgare Barke roots... 38 0.37
gb|AL505458.1|AL505458 AL505458 Hordeum vulgare Barke roots... 38 0.37
gb|AL509421.1|AL509421 AL509421 Hordeum vulgare Barke devel... 38 0.37
gb|AL509435.1|AL509435 AL509435 Hordeum vulgare Barke devel... 38 0.37
gb|BE602911.1|BE602911 HVSMEh0100N19f Hordeum vulgare 5-45 ... 38 0.37
gb|BF256261.3|BF256261 HVSMEf0009K14f Hordeum vulgare seedl... 38 0.37
gb|BF259826.3|BF259826 HVSMEf0020F22f Hordeum vulgare seedl... 38 0.37
gb|BG417229.2|BG417229 HVSMEk0016N21f Hordeum vulgare testa... 38 0.37
gb|BF065921.2|BF065921 HV_CEb0014F20f Hordeum vulgare seedl... 38 0.37
gb|AV914415.1|AV914415 AV914415 K. Sato unpublished cDNA li... 38 0.37
gb|AV918877.1|AV918877 AV918877 K. Sato unpublished cDNA li... 38 0.37
gb|AV919452.1|AV919452 AV919452 K. Sato unpublished cDNA li... 38 0.37
gb|AV921123.1|AV921123 AV921123 K. Sato unpublished cDNA li... 38 0.37
gb|AV930067.1|AV930067 AV930067 K. Sato unpublished cDNA li... 38 0.37
gb|BM816661.1|BM816661 HB01B05_T3.ab1 HB Hordeum vulgare su... 38 0.37
gb|AJ432113.1|AJ432113 AJ432113 S00002 Hordeum vulgare subs... 38 0.37
gb|AJ460329.1|AJ460329 AJ460329 S00002 Hordeum vulgare subs... 38 0.37
gb|AJ460330.1|AJ460330 AJ460330 S00002 Hordeum vulgare subs... 38 0.37
gb|BJ457411.1|BJ457411 BJ457411 K. Sato unpublished cDNA li... 38 0.37
gb|BJ463717.1|BJ463717 BJ463717 K. Sato unpublished cDNA li... 38 0.37
gb|BJ467889.1|BJ467889 BJ467889 K. Sato unpublished cDNA li... 38 0.37
gb|BJ467953.1|BJ467953 BJ467953 K. Sato unpublished cDNA li... 38 0.37
gb|BQ458632.1|BQ458632 HA04K10r HA Hordeum vulgare subsp. v... 38 0.37
gb|BQ460046.1|BQ460046 HA07G01r HA Hordeum vulgare subsp. v... 38 0.37
gb|BQ466010.1|BQ466010 HT01F03T HT Hordeum vulgare subsp. v... 38 0.37
gb|BQ656391.1|BQ656391 HA04K10u HA Hordeum vulgare subsp. v... 38 0.37
gb|BQ660750.1|BQ660750 HI05E12u HI Hordeum vulgare subsp. v... 38 0.37
gb|BQ664829.1|BQ664829 HX01A19w HX Hordeum vulgare subsp. v... 38 0.37
gb|BQ664924.1|BQ664924 HX01G21w HX Hordeum vulgare subsp. v... 38 0.37
gb|BQ665542.1|BQ665542 HX04B08u HX Hordeum vulgare subsp. v... 38 0.37
gb|BM377811.2|BM377811 EBem04_SQ004_E03_R embryo, 12 DPA, n... 38 0.37
gb|BM377929.2|BM377929 EBem04_SQ004_K01_R embryo, 12 DPA, n... 38 0.37
gb|BM373668.2|BM373668 EBma03_SQ002_E15_R maternal, 8 DPA, ... 38 0.37
gb|BM373777.2|BM373777 EBma03_SQ002_K14_R maternal, 8 DPA, ... 38 0.37
gb|BM373501.2|BM373501 EBma04_SQ004_K18_R maternal, 10 DPA,... 38 0.37
gb|BM098048.2|BM098048 EBpi03_SQ002_G10_R pistil, 4 DPA, no... 38 0.37
gb|BM374241.2|BM374241 EBpi03_SQ003_B04_R pistil, 4 DPA, no... 38 0.37
gb|BM098963.2|BM098963 EBpi05_SQ002_J01_R pistil, 8 DPA, no... 38 0.37
gb|BM098992.2|BM098992 EBpi05_SQ002_K08_R pistil, 8 DPA, no... 38 0.37
gb|BM099049.2|BM099049 EBpi05_SQ002_M21_R pistil, 8 DPA, no... 38 0.37
gb|BM443471.2|BM443471 EBro02_SQ005_E16_R root, 3 week, hyd... 38 0.37
gb|BM370339.2|BM370339 EBro08_SQ003_O10_R root, 3 week, dro... 38 0.37
gb|BQ766031.1|BQ766031 EBro03_SQ008_I19_R root, 3 week, wat... 38 0.37
gb|BQ766608.1|BQ766608 EBro08_SQ006_I13_R root, 3 week, dro... 38 0.37
gb|BU969637.1|BU969637 HB12C01r BC Hordeum vulgare subsp. v... 38 0.37
gb|BU970457.1|BU970457 HB14L05r BC Hordeum vulgare subsp. v... 38 0.37
gb|BU978247.1|BU978247 HA12N03r HA Hordeum vulgare subsp. v... 38 0.37
gb|BU978816.1|BU978816 HA14F18r HA Hordeum vulgare subsp. v... 38 0.37
gb|BU979057.1|BU979057 HA15A16r HA Hordeum vulgare subsp. v... 38 0.37
gb|BU980044.1|BU980044 HA18G02r HA Hordeum vulgare subsp. v... 38 0.37
gb|BU983162.1|BU983162 HA28L24r HA Hordeum vulgare subsp. v... 38 0.37
gb|BU985921.1|BU985921 HF09A19r HF Hordeum vulgare subsp. v... 38 0.37
gb|BU990041.1|BU990041 HF23N10r HF Hordeum vulgare subsp. v... 38 0.37
gb|BU990637.1|BU990637 HF25K02r HF Hordeum vulgare subsp. v... 38 0.37
gb|BU995252.1|BU995252 HM09K21r HM Hordeum vulgare subsp. v... 38 0.37
gb|BU996110.1|BU996110 HM12H16r HM Hordeum vulgare subsp. v... 38 0.37
gb|BU996827.1|BU996827 HM14O11r HM Hordeum vulgare subsp. v... 38 0.37
gb|CA006226.1|CA006226 HU14O20u HU Hordeum vulgare subsp. v... 38 0.37
gb|CA017081.1|CA017081 HV14O02u HV Hordeum vulgare subsp. v... 38 0.37
gb|CA019839.1|CA019839 HV13G11r HV Hordeum vulgare subsp. v... 38 0.37
gb|CA020292.1|CA020292 HV14O02r HV Hordeum vulgare subsp. v... 38 0.37
gb|CA025695.1|CA025695 HZ52O06r HZ Hordeum vulgare subsp. v... 38 0.37
gb|CA026033.1|CA026033 HZ53O09r HZ Hordeum vulgare subsp. v... 38 0.37
gb|CA026540.1|CA026540 HZ56D08r HZ Hordeum vulgare subsp. v... 38 0.37
gb|CA026734.1|CA026734 HZ56M17r HZ Hordeum vulgare subsp. v... 38 0.37
gb|CB859598.1|CB859598 HI10P11w HI Hordeum vulgare subsp. v... 38 0.37
gb|CD664088.1|CD664088 UCRHV18_07cf09_b1 Drought-stressed D... 38 0.37
gb|CV057365.1|CV057365 BNEL27a2 Barley EST endosperm librar... 38 0.37
gb|CV057882.1|CV057882 BNEL31h2 Barley EST endosperm librar... 38 0.37
gb|CV060242.1|CV060242 BNEL56a10 Barley EST endosperm libra... 38 0.37
gb|CV061389.1|CV061389 BNEL68c4 Barley EST endosperm librar... 38 0.37
gb|CV062537.1|CV062537 BNEL80b5 Barley EST endosperm librar... 38 0.37
gb|AF411228.1|AF411228 Hordeum vulgare ascorbate peroxidase... 38 0.37
>gb|CB883678.1|CB883678 HQ02P09w HQ Hordeum vulgare subsp. vulgare cDNA clone HQ02P09
3-PRIME, mRNA sequence
Length = 541
Score = 155 bits (78), Expect = 2e-036
Identities = 127/142 (89%), Gaps = 1/142 (0%)
Strand = Plus / Plus
Query: 215 tcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccaggatgc 274
||||||||||||| | |||||| |||||||| |||||||| || ||||||||||||||||
Sbjct: 15 tcacgcccatcgcgt-cctcgcgtggttccccttcgtgtccgagttccagaccaggatgc 73
Query: 275 tgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacacaaga 334
| ||||||||||| ||||||||||| |||||||||||||||||||| || || |||||||
Sbjct: 74 tcttcaaccaggctttcagcagaggcctgcagatctcccgtatcctcggcggccacaaga 133
Query: 335 aagaccgagggacccggaacaa 356
| ||||||| |||||||||||
Sbjct: 134 aggaccgagccacccggaacaa 155
>gb|BQ754043.1|BQ754043 EBca01_SQ002_K10_R carpel, pre-anthesis, no treatment, cv Optic,
EBca01 Hordeum vulgare subsp. vulgare cDNA clone
EBca01_SQ002_K10 5', mRNA sequence
Length = 440
Score = 149 bits (75), Expect = 1e-034
Identities = 114/127 (89%)
Strand = Plus / Plus
Query: 230 tcctcgcctggttcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgt 289
||||||| |||||||| |||||||| || ||||||||||||||||| ||||||||||| |
Sbjct: 22 tcctcgcgtggttccccttcgtgtccgagttccagaccaggatgctcttcaaccaggctt 81
Query: 290 tcagcagaggtctgcagatctcccgtatcctgggaggacacaagaaagaccgagggaccc 349
|||||||||| |||||||||||||||||||| || || |||||||| ||||||| ||||
Sbjct: 82 tcagcagaggcctgcagatctcccgtatcctcggcggccacaagaaggaccgagccaccc 141
Query: 350 ggaacaa 356
|||||||
Sbjct: 142 ggaacaa 148
>gb|AV927733.1|AV927733 AV927733 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd3g22 3', mRNA sequence
Length = 626
Score = 117 bits (59), Expect = 5e-025
Identities = 158/191 (82%)
Strand = Plus / Minus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 423 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 364
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 363 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 304
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacac 330
||||| ||||||||||| |||||| | |||||||||||||| | |||||||| || |||
Sbjct: 303 atgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcac 244
Query: 331 aagaaagaccg 341
||||| |||||
Sbjct: 243 aagaaggaccg 233
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 514 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 470
>gb|AV931607.1|AV931607 AV931607 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd23h13 3', mRNA sequence
Length = 508
Score = 117 bits (59), Expect = 5e-025
Identities = 158/191 (82%)
Strand = Plus / Minus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 426 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 367
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 366 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 307
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacac 330
||||| ||||||||||| |||||| | |||||||||||||| | |||||||| || |||
Sbjct: 306 atgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcac 247
Query: 331 aagaaagaccg 341
||||| |||||
Sbjct: 246 aagaaggaccg 236
Score = 40.1 bits (20), Expect = 0.094
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 73 tgcatccttgctttcatgcccactggatgggg 104
||||||||||| |||||||| || ||||||||
Sbjct: 504 tgcatccttgccttcatgccaacgggatgggg 473
>gb|AV931716.1|AV931716 AV931716 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd23o13 3', mRNA sequence
Length = 413
Score = 117 bits (59), Expect = 5e-025
Identities = 158/191 (82%)
Strand = Plus / Minus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 401 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 342
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 341 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 282
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacac 330
||||| ||||||||||| |||||| | |||||||||||||| | |||||||| || |||
Sbjct: 281 atgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcac 222
Query: 331 aagaaagaccg 341
||||| |||||
Sbjct: 221 aagaaggaccg 211
>gb|AV934689.1|AV934689 AV934689 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal1e06 3', mRNA sequence
Length = 678
Score = 117 bits (59), Expect = 5e-025
Identities = 158/191 (82%)
Strand = Plus / Minus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 477 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 418
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 417 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 358
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacac 330
||||| ||||||||||| |||||| | |||||||||||||| | |||||||| || |||
Sbjct: 357 atgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcac 298
Query: 331 aagaaagaccg 341
||||| |||||
Sbjct: 297 aagaaggaccg 287
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 568 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 524
>gb|AV936387.1|AV936387 AV936387 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal11c09 3', mRNA sequence
Length = 650
Score = 117 bits (59), Expect = 5e-025
Identities = 158/191 (82%)
Strand = Plus / Minus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 447 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 388
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 387 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 328
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacac 330
||||| ||||||||||| |||||| | |||||||||||||| | |||||||| || |||
Sbjct: 327 atgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcac 268
Query: 331 aagaaagaccg 341
||||| |||||
Sbjct: 267 aagaaggaccg 257
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 538 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 494
>gb|BJ473617.1|BJ473617 BJ473617 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal15l17 3', mRNA sequence
Length = 633
Score = 117 bits (59), Expect = 5e-025
Identities = 158/191 (82%)
Strand = Plus / Minus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 431 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 372
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 371 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 312
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacac 330
||||| ||||||||||| |||||| | |||||||||||||| | |||||||| || |||
Sbjct: 311 atgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcac 252
Query: 331 aagaaagaccg 341
||||| |||||
Sbjct: 251 aagaaggaccg 241
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 522 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 478
>gb|BJ475011.1|BJ475011 BJ475011 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal27j14 3', mRNA sequence
Length = 623
Score = 117 bits (59), Expect = 5e-025
Identities = 158/191 (82%)
Strand = Plus / Minus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 425 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 366
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 365 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 306
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacac 330
||||| ||||||||||| |||||| | |||||||||||||| | |||||||| || |||
Sbjct: 305 atgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcac 246
Query: 331 aagaaagaccg 341
||||| |||||
Sbjct: 245 aagaaggaccg 235
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 516 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 472
>gb|BJ477252.1|BJ477252 BJ477252 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal40n15 3', mRNA sequence
Length = 623
Score = 117 bits (59), Expect = 5e-025
Identities = 158/191 (82%)
Strand = Plus / Minus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 425 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 366
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 365 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 306
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacac 330
||||| ||||||||||| |||||| | |||||||||||||| | |||||||| || |||
Sbjct: 305 atgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcac 246
Query: 331 aagaaagaccg 341
||||| |||||
Sbjct: 245 aagaaggaccg 235
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 516 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 472
>gb|BQ661605.1|BQ661605 HM04E05u HM Hordeum vulgare subsp. vulgare cDNA clone HM04E05
3-PRIME, mRNA sequence
Length = 616
Score = 117 bits (59), Expect = 5e-025
Identities = 158/191 (82%)
Strand = Plus / Minus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 487 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 428
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 427 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 368
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacac 330
||||| ||||||||||| |||||| | |||||||||||||| | |||||||| || |||
Sbjct: 367 atgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcac 308
Query: 331 aagaaagaccg 341
||||| |||||
Sbjct: 307 aagaaggaccg 297
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 578 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 534
>gb|CD663693.1|CD663693 UCRHV18_06bd04_b1 Drought-stressed Dicktoo barley epidermis cDNA
library Hordeum vulgare subsp. vulgare cDNA clone
UCRHV18_06bd04, mRNA sequence
Length = 550
Score = 117 bits (59), Expect = 5e-025
Identities = 158/191 (82%)
Strand = Plus / Minus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 511 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 452
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 451 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 392
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacac 330
||||| ||||||||||| |||||| | |||||||||||||| | |||||||| || |||
Sbjct: 391 atgctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcac 332
Query: 331 aagaaagaccg 341
||||| |||||
Sbjct: 331 aagaaggaccg 321
>gb|CD663695.1|CD663695 UCRHV18_06bd07_b1 Drought-stressed Dicktoo barley epidermis cDNA
library Hordeum vulgare subsp. vulgare cDNA clone
UCRHV18_06bd07, mRNA sequence
Length = 506
Score = 109 bits (55), Expect = 1e-022
Identities = 130/155 (83%)
Strand = Plus / Minus
Query: 187 tacgagatcctgatgggacttctcctgttcacgcccatcgccttcctcgcctggttcccg 246
||||||||| | ||||| || || || ||||| || ||||| ||||| || |||||||||
Sbjct: 480 tacgagatcatcatggggctgctgctcttcaccccgatcgcgttcctggcgtggttcccg 421
Query: 247 ttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcagaggtctgcag 306
|||||||| || |||||||| ||||||| ||||||||||| |||||| | |||||||||
Sbjct: 420 ttcgtgtctgagttccagactcggatgctcttcaaccaggccttcagccgtggtctgcag 361
Query: 307 atctcccgtatcctgggaggacacaagaaagaccg 341
||||| | |||||||| || |||||||| |||||
Sbjct: 360 atctcgaggatcctgggtgggcacaagaaggaccg 326
>gb|AV931608.1|AV931608 AV931608 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd23h14 3', mRNA sequence
Length = 358
Score = 107 bits (54), Expect = 5e-022
Identities = 152/185 (82%)
Strand = Plus / Minus
Query: 157 tggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctcctgttc 216
||||| |||||| |||||| || || || ||||||||| | ||||| | || || |||
Sbjct: 320 tgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggntgctgctcttc 261
Query: 217 acgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccaggatgctg 276
|| || ||||| ||||| || ||||||||||||||||| || |||||||| |||||||
Sbjct: 260 accccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatgctc 201
Query: 277 ttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacacaagaaa 336
||||||||||| |||||| | |||||||||||||| | |||||||| || ||||||||
Sbjct: 200 ttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaagaag 141
Query: 337 gaccg 341
|||||
Sbjct: 140 gaccg 136
>gb|BJ469981.1|BJ469981 BJ469981 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal14k06 5', mRNA sequence
Length = 483
Score = 103 bits (52), Expect = 8e-021
Identities = 109/128 (85%)
Strand = Plus / Plus
Query: 214 ttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccaggatg 273
||||| || ||||| ||||| || ||||||||||||||||| || |||||||| |||||
Sbjct: 37 ttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatg 96
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacacaag 333
|| ||||||||||| |||||| | |||||||||||||| | |||||||| || ||||||
Sbjct: 97 ctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaag 156
Query: 334 aaagaccg 341
|| |||||
Sbjct: 157 aaggaccg 164
>gb|BJ472233.1|BJ472233 BJ472233 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal32p02 5', mRNA sequence
Length = 471
Score = 103 bits (52), Expect = 8e-021
Identities = 109/128 (85%)
Strand = Plus / Plus
Query: 214 ttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccaggatg 273
||||| || ||||| ||||| || ||||||||||||||||| || |||||||| |||||
Sbjct: 25 ttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatg 84
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacacaag 333
|| ||||||||||| |||||| | |||||||||||||| | |||||||| || ||||||
Sbjct: 85 ctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaag 144
Query: 334 aaagaccg 341
|| |||||
Sbjct: 145 aaggaccg 152
>gb|BJ473277.1|BJ473277 BJ473277 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal41i04 5', mRNA sequence
Length = 474
Score = 103 bits (52), Expect = 8e-021
Identities = 109/128 (85%)
Strand = Plus / Plus
Query: 214 ttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccaggatg 273
||||| || ||||| ||||| || ||||||||||||||||| || |||||||| |||||
Sbjct: 28 ttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatg 87
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacacaag 333
|| ||||||||||| |||||| | |||||||||||||| | |||||||| || ||||||
Sbjct: 88 ctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaag 147
Query: 334 aaagaccg 341
|| |||||
Sbjct: 148 aaggaccg 155
>gb|BJ474020.1|BJ474020 BJ474020 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal18e21 3', mRNA sequence
Length = 393
Score = 103 bits (52), Expect = 8e-021
Identities = 109/128 (85%)
Strand = Plus / Minus
Query: 214 ttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccaggatg 273
||||| || ||||| ||||| || ||||||||||||||||| || |||||||| |||||
Sbjct: 368 ttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatg 309
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacacaag 333
|| ||||||||||| |||||| | |||||||||||||| | |||||||| || ||||||
Sbjct: 308 ctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaag 249
Query: 334 aaagaccg 341
|| |||||
Sbjct: 248 aaggaccg 241
>gb|BJ474554.1|BJ474554 BJ474554 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal14k06 3', mRNA sequence
Length = 415
Score = 103 bits (52), Expect = 8e-021
Identities = 109/128 (85%)
Strand = Plus / Minus
Query: 214 ttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccaggatg 273
||||| || ||||| ||||| || ||||||||||||||||| || |||||||| |||||
Sbjct: 390 ttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatg 331
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacacaag 333
|| ||||||||||| |||||| | |||||||||||||| | |||||||| || ||||||
Sbjct: 330 ctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaag 271
Query: 334 aaagaccg 341
|| |||||
Sbjct: 270 aaggaccg 263
>gb|BJ476230.1|BJ476230 BJ476230 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal32p02 3', mRNA sequence
Length = 414
Score = 103 bits (52), Expect = 8e-021
Identities = 109/128 (85%)
Strand = Plus / Minus
Query: 214 ttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccaggatg 273
||||| || ||||| ||||| || ||||||||||||||||| || |||||||| |||||
Sbjct: 389 ttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcggatg 330
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacacaag 333
|| ||||||||||| |||||| | |||||||||||||| | |||||||| || ||||||
Sbjct: 329 ctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaag 270
Query: 334 aaagaccg 341
|| |||||
Sbjct: 269 aaggaccg 262
>gb|BJ471422.1|BJ471422 BJ471422 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal18e21 5', mRNA sequence
Length = 447
Score = 93.7 bits (47), Expect = 7e-018
Identities = 107/128 (83%)
Strand = Plus / Plus
Query: 214 ttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccaggatg 273
||||| || |||| ||||| || ||||||||||||||| | || |||||||| |||||
Sbjct: 10 ttcaccccgatcgnnttcctggcgtggttcccgttcgtgnctgagttccagactcggatg 69
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggacacaag 333
|| ||||||||||| |||||| | |||||||||||||| | |||||||| || ||||||
Sbjct: 70 ctcttcaaccaggccttcagccgtggtctgcagatctcgaggatcctgggtgggcacaag 129
Query: 334 aaagaccg 341
|| |||||
Sbjct: 130 aaggaccg 137
>gb|BJ477461.1|BJ477461 BJ477461 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal41i04 3', mRNA sequence
Length = 405
Score = 89.7 bits (45), Expect = 1e-016
Identities = 89/104 (85%)
Strand = Plus / Minus
Query: 238 tggttcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcaga 297
||||||||||||||||| | |||||||| ||||||| ||||||||||| |||||| |
Sbjct: 389 tggttcccgttcgtgtctnagttccagactcggatgctcttcaaccaggccttcagccgt 330
Query: 298 ggtctgcagatctcccgtatcctgggaggacacaagaaagaccg 341
|||||||||||||| | |||||||| || |||||||| |||||
Sbjct: 329 ggtctgcagatctcgaggatcctgggtgggcacaagaaggaccg 286
>gb|BM377017.2|BM377017 EBem05_SQ003_O02_R embryo, 14 DPA, no treatment, cv Optic, EBem05
Hordeum vulgare subsp. vulgare cDNA clone
EBem05_SQ003_O02 5', mRNA sequence
Length = 466
Score = 87.7 bits (44), Expect = 4e-016
Identities = 131/160 (81%)
Strand = Plus / Plus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||| ||||| | ||||| || ||
Sbjct: 307 gggctgtgggggtcgatccgggctctagctcgtgggtaccagatcatcatggggctgctg 366
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| ||
Sbjct: 367 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcgg 426
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatct 310
||||| |||||||| || |||||| | |||||||||||||
Sbjct: 427 atgctcttcaaccaagccttcagccgtggtctgcagatct 466
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 216 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 260
>gb|BM374568.2|BM374568 EBpi03_SQ003_P19_R pistil, 4 DPA, no treatment, cv Optic, EBpi03
Hordeum vulgare subsp. vulgare cDNA clone
EBpi03_SQ003_P19 5', mRNA sequence
Length = 425
Score = 81.8 bits (41), Expect = 3e-014
Identities = 68/77 (88%)
Strand = Plus / Plus
Query: 238 tggttcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcaga 297
|||||||| ||||| || || |||||||| ||||||||||||||||||||||||| |||
Sbjct: 103 tggttccccttcgtctccgagttccagacgcggatgctgttcaaccaggcgttcagtaga 162
Query: 298 ggtctgcagatctcccg 314
|| |||||||| |||||
Sbjct: 163 gggctgcagatatcccg 179
>gb|BU972175.1|BU972175 HB20N14r BC Hordeum vulgare subsp. vulgare cDNA clone HB20N14
5-PRIME, mRNA sequence
Length = 373
Score = 81.8 bits (41), Expect = 3e-014
Identities = 68/77 (88%)
Strand = Plus / Plus
Query: 238 tggttcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcaga 297
|||||||| ||||| || || |||||||| ||||||||||||||||||||||||| |||
Sbjct: 210 tggttccccttcgtctccgagttccagacgcggatgctgttcaaccaggcgttcagtaga 269
Query: 298 ggtctgcagatctcccg 314
|| |||||||| |||||
Sbjct: 270 gggctgcagatatcccg 286
Score = 38.2 bits (19), Expect = 0.37
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 61 gacatatttgtttgcatccttgctttcatgcccactggatggggtttgctgctgattgc 119
|||||| |||| ||| |||| || ||| ||||||| |||||||| | |||||||||||
Sbjct: 33 gacatacttgtctgcttcctggcattcttgcccaccggatggggaatactgctgattgc 91
>gb|BF265457.3|BF265457 HV_CEa0012F07f Hordeum vulgare seedling green leaf EST library
HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEa0012F07f, mRNA sequence
Length = 654
Score = 77.8 bits (39), Expect = 4e-013
Identities = 129/158 (81%), Gaps = 1/158 (0%)
Strand = Plus / Plus
Query: 151 gggctctggggctcgatcaaggctcttgcccggggctacgagatcctgatgggacttctc 210
||||| ||||| |||||| |||||| || || || ||||||||| | ||||| || ||
Sbjct: 498 gggctgtgggggtcgatccgggctctagctcgtgggtacgagatcatcatggggctgctg 557
Query: 211 ctgttcacgcccatcgccttcctcgcctggttcccgttcgtgtcggaattccagaccagg 270
|| ||||| || ||||| ||||| || ||||||||||||||||| || |||||||| |
Sbjct: 558 ctcttcaccccgatcgcgttcctggcgtggttcccgttcgtgtctgagttccagactcng 617
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagat 308
||||| || |||||||| |||||| | |||||||||||
Sbjct: 618 atgctctt-aaccaggccttcagccgtggtctgcagat 654
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 407 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 451
>gb|BG418430.1|BG418430 HVSMEk0022K21f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0022K21f, mRNA sequence
Length = 507
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 400 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 444
>gb|AV926707.1|AV926707 AV926707 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd23h13 5', mRNA sequence
Length = 495
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 355 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 399
>gb|AV926824.1|AV926824 AV926824 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd23o13 5', mRNA sequence
Length = 413
Score = 50.1 bits (25), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 60 ggacatatttgtttgcatccttgctttcatgcccactggatgggg 104
||||||||| || ||||||||||| |||||||| || ||||||||
Sbjct: 326 ggacatattcgtctgcatccttgccttcatgccaacgggatgggg 370
>gb|BM101006.1|BM101006 EBpi01_SQ002_J05_R pistil, 1 DPA, no treatment, cv Optic, EBpi01
Hordeum vulgare subsp. vulgare cDNA clone
EBpi01_SQ002_J05 5', mRNA sequence
Length = 342
Score = 48.1 bits (24), Expect = 4e-004
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctccc 313
|||||||||||||| |||||| | |||||| |||||||||
Sbjct: 16 ctgttcaaccaggccttcagccgtggtctggagatctccc 55
>gb|BU995906.1|BU995906 HM11L21r HM Hordeum vulgare subsp. vulgare cDNA clone HM11L21
5-PRIME, mRNA sequence
Length = 641
Score = 48.1 bits (24), Expect = 4e-004
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctccc 313
|||||||||||||| |||||| | |||||| |||||||||
Sbjct: 291 ctgttcaaccaggccttcagccgtggtctggagatctccc 330
>gb|CB882058.1|CB882058 HM11L21w HM Hordeum vulgare subsp. vulgare cDNA clone HM11L21
3-PRIME, mRNA sequence
Length = 585
Score = 48.1 bits (24), Expect = 4e-004
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctccc 313
|||||||||||||| |||||| | |||||| |||||||||
Sbjct: 354 ctgttcaaccaggccttcagccgtggtctggagatctccc 315
>gb|CD662722.1|CD662722 UCRHV18_02df07_b1 Drought-stressed Dicktoo barley epidermis cDNA
library Hordeum vulgare subsp. vulgare cDNA clone
UCRHV18_02df07, mRNA sequence
Length = 676
Score = 48.1 bits (24), Expect = 4e-004
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 274 ctgttcaaccaggcgttcagcagaggtctgcagatctccc 313
|||||||||||||| |||||| | |||||| |||||||||
Sbjct: 447 ctgttcaaccaggccttcagccgtggtctggagatctccc 408
>gb|AV837078.1|AV837078 AV837078 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
vulgare seedling leaves second leaf stage Hordeum
vulgare subsp. vulgare cDNA clone basd19k01, mRNA
sequence
Length = 618
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 274 ctgttcaaccaggcgttcagcagaggt 300
|||||||||||||| ||||||||||||
Sbjct: 376 ctgttcaaccaggctttcagcagaggt 350
>gb|BG415664.1|BG415664 HVSMEk0007G03f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0007G03f, mRNA sequence
Length = 641
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 274 ctgttcaaccaggcgttcagcagaggt 300
|||||||||||||| ||||||||||||
Sbjct: 289 ctgttcaaccaggctttcagcagaggt 263
>gb|BG417338.1|BG417338 HVSMEk0017J08f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0017J08f, mRNA sequence
Length = 839
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 274 ctgttcaaccaggcgttcagcagaggt 300
|||||||||||||| ||||||||||||
Sbjct: 371 ctgttcaaccaggctttcagcagaggt 397
>gb|BG418775.1|BG418775 HVSMEk0024G07f Hordeum vulgare testa/pericarp EST library
HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEk0024G07f, mRNA sequence
Length = 834
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 274 ctgttcaaccaggcgttcagcagaggt 300
|||||||||||||| ||||||||||||
Sbjct: 593 ctgttcaaccaggctttcagcagaggt 619
>gb|AJ461988.1|AJ461988 AJ461988 S00002 Hordeum vulgare subsp. vulgare cDNA clone
S0000200051G08F1, mRNA sequence
Length = 300
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 274 ctgttcaaccaggcgttcagcagaggt 300
|||||||||||||| ||||||||||||
Sbjct: 147 ctgttcaaccaggctttcagcagaggt 173
>gb|BJ474560.1|BJ474560 BJ474560 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal14l04 3', mRNA sequence
Length = 478
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 274 ctgttcaaccaggcgttcagcagaggt 300
|||||||||||||| ||||||||||||
Sbjct: 352 ctgttcaaccaggctttcagcagaggt 326
>gb|CA018258.1|CA018258 HV08B15r HV Hordeum vulgare subsp. vulgare cDNA clone HV08B15
5-PRIME, mRNA sequence
Length = 654
Score = 46.1 bits (23), Expect = 0.002
Identities = 44/51 (86%)
Strand = Plus / Plus
Query: 48 catgacggtgctggacatatttgtttgcatccttgctttcatgcccactgg 98
|||||| || || ||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 604 catgacagtcctcgacatctttgtctgcatcctcgctttcatgccgactgg 654
>gb|CB876259.1|CB876259 HX10M03w HX Hordeum vulgare subsp. vulgare cDNA clone HX10M03
3-PRIME, mRNA sequence
Length = 559
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 274 ctgttcaaccaggcgttcagcagaggt 300
|||||||||||||| ||||||||||||
Sbjct: 380 ctgttcaaccaggctttcagcagaggt 354
>gb|AY177665.1| Hordeum vulgare subsp. vulgare putative callose synthase mRNA,
complete cds
Length = 6180
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 274 ctgttcaaccaggcgttcagcagaggt 300
|||||||||||||| ||||||||||||
Sbjct: 5763 ctgttcaaccaggctttcagcagaggt 5789
>gb|CD663772.1|CD663772 UCRHV18_06cd06_b1 Drought-stressed Dicktoo barley epidermis cDNA
library Hordeum vulgare subsp. vulgare cDNA clone
UCRHV18_06cd06, mRNA sequence
Length = 639
Score = 44.1 bits (22), Expect = 0.006
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 275 tgttcaaccaggcgttcagcagaggt 300
||||||||||||| ||||||||||||
Sbjct: 413 tgttcaaccaggctttcagcagaggt 388
>gb|BE216855.1|BE216855 HV_CEb0011N08f Hordeum vulgare seedling green leaf EST library
HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEb0011N08f, mRNA sequence
Length = 958
Score = 40.1 bits (20), Expect = 0.094
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 aattcggcacgagcagccat 20
||||||||||||||||||||
Sbjct: 8 aattcggcacgagcagccat 27
>gb|BE437255.1|BE437255 SFR003.A06F990621 ITEC SFR Barley Leaf Epidermis Library Hordeum
vulgare subsp. vulgare cDNA clone SF, mRNA sequence
Length = 561
Score = 38.2 bits (19), Expect = 0.37
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 368 gggctgctgctgattcaag 386
|||||||||||||||||||
Sbjct: 246 gggctgctgctgattcaag 264
>gb|AL499895.1|AL499895 AL499895 Hordeum vulgare Barke etiolated leaves Hordeum vulgare
subsp. vulgare cDNA clone HK03P15r 3', mRNA sequence
Length = 610
Score = 38.2 bits (19), Expect = 0.37
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 368 gggctgctgctgattcaag 386
|||||||||||||||||||
Sbjct: 332 gggctgctgctgattcaag 314
>gb|AL500177.1|AL500177 AL500177 Hordeum vulgare Barke etiolated leaves Hordeum vulgare
subsp. vulgare cDNA clone HK05E11r 3', mRNA sequence
Length = 604
Score = 38.2 bits (19), Expect = 0.37
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 368 gggctgctgctgattcaag 386
|||||||||||||||||||
Sbjct: 342 gggctgctgctgattcaag 324
>gb|AL502723.1|AL502723 AL502723 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW08I16u 3', mRNA sequence
Length = 530
Score = 38.2 bits (19), Expect = 0.37
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 368 gggctgctgctgattcaag 386
|||||||||||||||||||
Sbjct: 337 gggctgctgctgattcaag 319
>gb|AL503065.1|AL503065 AL503065 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW09J15u 3', mRNA sequence
Length = 633
Score = 38.2 bits (19), Expect = 0.37
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 368 gggctgctgctgattcaag 386
|||||||||||||||||||
Sbjct: 321 gggctgctgctgattcaag 303
>gb|AL505458.1|AL505458 AL505458 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare
cDNA clone HW08I16V 5', mRNA sequence
Length = 700
Score = 38.2 bits (19), Expect = 0.37
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 368 gggctgctgctgattcaag 386
|||||||||||||||||||
Sbjct: 529 gggctgctgctgattcaag 547
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 71,488
Number of Sequences: 312970
Number of extensions: 71488
Number of successful extensions: 27841
Number of sequences better than 0.5: 121
Number of HSP's better than 0.5 without gapping: 121
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27694
Number of HSP's gapped (non-prelim): 145
length of query: 690
length of database: 175,134,539
effective HSP length: 19
effective length of query: 671
effective length of database: 169,188,109
effective search space: 113525221139
effective search space used: 113525221139
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)