BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2192890.2.1
(531 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA018182.1|CA018182 HV07N17r HV Hordeum vulgare subsp. v... 64 5e-009
gb|BM444310.1|BM444310 EBem09_SQ004_M13_R embryo, 1 Day ger... 62 2e-008
gb|AJ435779.1|AJ435779 AJ435779 S00002 Hordeum vulgare subs... 62 2e-008
gb|BQ661154.1|BQ661154 HM02C21u HM Hordeum vulgare subsp. v... 62 2e-008
gb|BM375914.2|BM375914 EBem06_SQ004_M08_R embryo, 21 DPA, n... 62 2e-008
gb|BM443663.2|BM443663 EBem09_SQ001_B11_R embryo, 1 Day ger... 62 2e-008
gb|BM099996.2|BM099996 EBes01_SQ004_N20_R embryo sac, 4-6 D... 62 2e-008
gb|BM100336.2|BM100336 EBma01_SQ001_O08_R maternal, 4 DPA, ... 62 2e-008
gb|BM096584.2|BM096584 EBma05_SQ001_O10_R maternal, 12 DPA,... 62 2e-008
gb|BQ762754.1|BQ762754 EBro02_SQ006_A06_R root, 3 week, hyd... 62 2e-008
gb|BQ762872.1|BQ762872 EBro02_SQ006_J11_R root, 3 week, hyd... 62 2e-008
gb|BQ763123.1|BQ763123 EBro02_SQ007_E08_R root, 3 week, hyd... 62 2e-008
gb|BQ764573.1|BQ764573 EBca01_SQ004_D09_R carpel, pre-anthe... 62 2e-008
gb|BU980628.1|BU980628 HA21D12r HA Hordeum vulgare subsp. v... 62 2e-008
gb|BU983574.1|BU983574 HA30D01r HA Hordeum vulgare subsp. v... 62 2e-008
gb|BU995145.1|BU995145 HM09F13r HM Hordeum vulgare subsp. v... 62 2e-008
gb|BU995148.1|BU995148 HM09F17r HM Hordeum vulgare subsp. v... 62 2e-008
gb|CA028837.1|CA028837 HZ63G10r HZ Hordeum vulgare subsp. v... 62 2e-008
gb|CV059028.1|CV059028 BNEL43f1 Barley EST endosperm librar... 62 2e-008
gb|CV059239.1|CV059239 BNEL45h9 Barley EST endosperm librar... 62 2e-008
gb|CV059248.1|CV059248 BNEL46a6 Barley EST endosperm librar... 62 2e-008
gb|CV059268.1|CV059268 BNEL46c4 Barley EST endosperm librar... 62 2e-008
gb|CV059757.1|CV059757 BNEL50f2 Barley EST endosperm librar... 62 2e-008
gb|CV060019.1|CV060019 BNEL53e2 Barley EST endosperm librar... 62 2e-008
gb|CV060136.1|CV060136 BNEL54g9 Barley EST endosperm librar... 62 2e-008
gb|CV061379.1|CV061379 BNEL68b6 Barley EST endosperm librar... 62 2e-008
gb|CV062256.1|CV062256 BNEL78a4 Barley EST endosperm librar... 62 2e-008
gb|CV062595.1|CV062595 BNEL80g6 Barley EST endosperm librar... 62 2e-008
gb|CV063027.1|CV063027 BNEL85g9 Barley EST endosperm librar... 62 2e-008
gb|CV063348.1|CV063348 BNEL89d1 Barley EST endosperm librar... 62 2e-008
gb|BF256359.2|BF256359 HVSMEf0009F17f Hordeum vulgare seedl... 46 0.001
gb|BU967680.1|BU967680 HB05B05r BC Hordeum vulgare subsp. v... 46 0.001
gb|BU967714.1|BU967714 HB05C19r BC Hordeum vulgare subsp. v... 46 0.001
gb|BF624746.3|BF624746 HVSMEa0017K03f Hordeum vulgare seedl... 38 0.28
gb|BF620317.2|BF620317 HVSMEc0019G24f Hordeum vulgare seedl... 38 0.28
gb|BG365541.1|BG365541 HVSMEi0003C04f Hordeum vulgare 20 DA... 38 0.28
gb|BG343418.2|BG343418 HVSMEg0005L07f Hordeum vulgare pre-a... 38 0.28
gb|BF267415.3|BF267415 HV_CEa0017N20f Hordeum vulgare seedl... 38 0.28
gb|AV917010.1|AV917010 AV917010 K. Sato unpublished cDNA li... 38 0.28
gb|BQ466225.1|BQ466225 HT01P02T HT Hordeum vulgare subsp. v... 38 0.28
gb|BM099943.2|BM099943 EBes01_SQ004_L13_R embryo sac, 4-6 D... 38 0.28
gb|BM100012.2|BM100012 EBes01_SQ004_O13_R embryo sac, 4-6 D... 38 0.28
gb|BQ753630.1|BQ753630 EBan01_SQ004_M20_R anther, yellow st... 38 0.28
gb|BU977443.1|BU977443 HA11H02r HA Hordeum vulgare subsp. v... 38 0.28
gb|BU996284.1|BU996284 HM13B23r HM Hordeum vulgare subsp. v... 38 0.28
gb|BU996575.1|BU996575 HM14A23r HM Hordeum vulgare subsp. v... 38 0.28
gb|BU996680.1|BU996680 HM14G10r HM Hordeum vulgare subsp. v... 38 0.28
gb|CA011698.1|CA011698 HT03E22r HT Hordeum vulgare subsp. v... 38 0.28
gb|CA018161.1|CA018161 HV07L15r HV Hordeum vulgare subsp. v... 38 0.28
>gb|CA018182.1|CA018182 HV07N17r HV Hordeum vulgare subsp. vulgare cDNA clone HV07N17
5-PRIME, mRNA sequence
Length = 230
Score = 63.9 bits (32), Expect = 5e-009
Identities = 68/80 (85%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 102 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 161
Query: 152 attataagctgctgaaggct 171
| ||||| |||| ||||||
Sbjct: 162 actataaagtgctcaaggct 181
>gb|BM444310.1|BM444310 EBem09_SQ004_M13_R embryo, 1 Day germination, no treatment, cv
Optic, EBem09 Hordeum vulgare subsp. vulgare cDNA clone
EBem09_SQ004_M13 5', mRNA sequence
Length = 419
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 67 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 126
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 127 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 186
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 187 ttggtgacctgatgg 201
>gb|AJ435779.1|AJ435779 AJ435779 S00002 Hordeum vulgare subsp. vulgare cDNA clone
S0000200083C12F1, mRNA sequence
Length = 442
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 82 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 141
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 142 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 201
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 202 ttggtgacctgatgg 216
>gb|BQ661154.1|BQ661154 HM02C21u HM Hordeum vulgare subsp. vulgare cDNA clone HM02C21
3-PRIME, mRNA sequence
Length = 392
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Minus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 315 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 256
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 255 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 196
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 195 ttggtgacctgatgg 181
>gb|BM375914.2|BM375914 EBem06_SQ004_M08_R embryo, 21 DPA, no treatment, cv Optic, EBem06
Hordeum vulgare subsp. vulgare cDNA clone
EBem06_SQ004_M08 5', mRNA sequence
Length = 486
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 89 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 148
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 149 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 208
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 209 ttggtgacctgatgg 223
>gb|BM443663.2|BM443663 EBem09_SQ001_B11_R embryo, 1 Day germination, no treatment, cv
Optic, EBem09 Hordeum vulgare subsp. vulgare cDNA clone
EBem09_SQ001_B11 5', mRNA sequence
Length = 369
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 43 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 102
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 103 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 162
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 163 ttggtgacctgatgg 177
>gb|BM099996.2|BM099996 EBes01_SQ004_N20_R embryo sac, 4-6 DPA, no treatment, cv Optic,
EBes01 Hordeum vulgare subsp. vulgare cDNA clone
EBes01_SQ004_N20 5', mRNA sequence
Length = 374
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 44 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 103
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 104 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 163
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 164 ttggtgacctgatgg 178
>gb|BM100336.2|BM100336 EBma01_SQ001_O08_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ001_O08 5', mRNA sequence
Length = 420
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 82 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 141
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 142 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 201
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 202 ttggtgacctgatgg 216
>gb|BM096584.2|BM096584 EBma05_SQ001_O10_R maternal, 12 DPA, no treatment, cv Optic, EBma05
Hordeum vulgare subsp. vulgare cDNA clone
EBma05_SQ001_O10 5', mRNA sequence
Length = 360
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 89 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 148
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 149 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 208
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 209 ttggtgacctgatgg 223
>gb|BQ762754.1|BQ762754 EBro02_SQ006_A06_R root, 3 week, hydroponic grown, low nitrogen, cv
Optic, EBro02 Hordeum vulgare subsp. vulgare cDNA clone
EBro02_SQ006_A06 5', mRNA sequence
Length = 318
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 42 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 101
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 102 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 161
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 162 ttggtgacctgatgg 176
>gb|BQ762872.1|BQ762872 EBro02_SQ006_J11_R root, 3 week, hydroponic grown, low nitrogen, cv
Optic, EBro02 Hordeum vulgare subsp. vulgare cDNA clone
EBro02_SQ006_J11 5', mRNA sequence
Length = 384
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 49 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 108
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 109 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 168
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 169 ttggtgacctgatgg 183
>gb|BQ763123.1|BQ763123 EBro02_SQ007_E08_R root, 3 week, hydroponic grown, low nitrogen, cv
Optic, EBro02 Hordeum vulgare subsp. vulgare cDNA clone
EBro02_SQ007_E08 5', mRNA sequence
Length = 447
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 93 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 152
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 153 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 212
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 213 ttggtgacctgatgg 227
>gb|BQ764573.1|BQ764573 EBca01_SQ004_D09_R carpel, pre-anthesis, no treatment, cv Optic,
EBca01 Hordeum vulgare subsp. vulgare cDNA clone
EBca01_SQ004_D09 5', mRNA sequence
Length = 533
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 84 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 143
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 144 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 203
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 204 ttggtgacctgatgg 218
>gb|BU980628.1|BU980628 HA21D12r HA Hordeum vulgare subsp. vulgare cDNA clone HA21D12
5-PRIME, mRNA sequence
Length = 420
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 88 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 147
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 148 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 207
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 208 ttggtgacctgatgg 222
>gb|BU983574.1|BU983574 HA30D01r HA Hordeum vulgare subsp. vulgare cDNA clone HA30D01
5-PRIME, mRNA sequence
Length = 378
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 80 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 139
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 140 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 199
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 200 ttggtgacctgatgg 214
>gb|BU995145.1|BU995145 HM09F13r HM Hordeum vulgare subsp. vulgare cDNA clone HM09F13
5-PRIME, mRNA sequence
Length = 544
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 54 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 113
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 114 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 173
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 174 ttggtgacctgatgg 188
>gb|BU995148.1|BU995148 HM09F17r HM Hordeum vulgare subsp. vulgare cDNA clone HM09F17
5-PRIME, mRNA sequence
Length = 347
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 54 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 113
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 114 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 173
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 174 ttggtgacctgatgg 188
>gb|CA028837.1|CA028837 HZ63G10r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ63G10
5-PRIME, mRNA sequence
Length = 376
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 101 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 160
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 161 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 220
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 221 ttggtgacctgatgg 235
>gb|CV059028.1|CV059028 BNEL43f1 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL43f1 5' similar to Unknown
Function, mRNA sequence
Length = 399
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 44 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 103
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 104 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 163
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 164 ttggtgacctgatgg 178
>gb|CV059239.1|CV059239 BNEL45h9 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL45h9 5' similar to Unknown
Function, mRNA sequence
Length = 399
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 44 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 103
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 104 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 163
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 164 ttggtgacctgatgg 178
>gb|CV059248.1|CV059248 BNEL46a6 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL46a6 5' similar to putative 60S
ribosomal protein L18A, mRNA sequence
Length = 627
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 81 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 140
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 141 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 200
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 201 ttggtgacctgatgg 215
>gb|CV059268.1|CV059268 BNEL46c4 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL46c4 5' similar to Unknown
Function, mRNA sequence
Length = 446
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 51 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 110
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 111 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 170
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 171 ttggtgacctgatgg 185
>gb|CV059757.1|CV059757 BNEL50f2 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL50f2 5' similar to Unknown
Function, mRNA sequence
Length = 446
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 51 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 110
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 111 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 170
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 171 ttggtgacctgatgg 185
>gb|CV060019.1|CV060019 BNEL53e2 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL53e2 5' similar to Unknown
Function, mRNA sequence
Length = 512
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 81 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 140
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 141 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 200
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 201 ttggtgacctgatgg 215
>gb|CV060136.1|CV060136 BNEL54g9 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL54g9 5' similar to Oryza sativa,
mRNA sequence
Length = 611
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 81 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 140
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 141 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 200
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 201 ttggtgacctgatgg 215
>gb|CV061379.1|CV061379 BNEL68b6 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL68b6 5' similar to Unknown
Function, mRNA sequence
Length = 399
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 44 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 103
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 104 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 163
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 164 ttggtgacctgatgg 178
>gb|CV062256.1|CV062256 BNEL78a4 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL78a4 5' similar to Unknown
Function, mRNA sequence
Length = 446
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 51 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 110
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 111 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 170
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 171 ttggtgacctgatgg 185
>gb|CV062595.1|CV062595 BNEL80g6 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL80g6 5' similar to Unknown
Function, mRNA sequence
Length = 446
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 51 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 110
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 111 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 170
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 171 ttggtgacctgatgg 185
>gb|CV063027.1|CV063027 BNEL85g9 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL85g9 5' similar to Unknown
Function, mRNA sequence
Length = 446
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 51 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 110
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 111 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 170
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 171 ttggtgacctgatgg 185
>gb|CV063348.1|CV063348 BNEL89d1 Barley EST endosperm library Hordeum vulgare subsp.
vulgare cDNA clone BNEL89d1 5' similar to Unknown
Function, mRNA sequence
Length = 399
Score = 61.9 bits (31), Expect = 2e-008
Identities = 109/135 (80%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||||||||||||| ||| ||| |||| ||||||| |||||||||||||||||| |||
Sbjct: 44 tggagaagctcaagagcctgtggaactcccaggtcatggacgaggagcagtgggcggtca 103
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 104 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 163
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 164 ttggtgacctgatgg 178
>gb|BF256359.2|BF256359 HVSMEf0009F17f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0009F17f, mRNA sequence
Length = 254
Score = 46.1 bits (23), Expect = 0.001
Identities = 107/135 (79%)
Strand = Plus / Plus
Query: 92 tggagaagctcaaggtcctctgggactcgcaggtcaacgacgaggagcagtgggcgctca 151
|||| ||||||||| ||| ||| |||| || |||| |||||||||||||||||| |||
Sbjct: 76 tggataagctcaagagcctgtggaactcccacgtcatggacgaggagcagtgggcggtca 135
Query: 152 attataagctgctgaaggctgctggtctgtttgcgggatccatcttcctgatgcggaact 211
| |||| |||| |||||| | || | ||||| ||||| ||||| ||||||| | ||
Sbjct: 136 actatagagtgctcaaggctacggggatttttgctggatctatctttttgatgcgcacct 195
Query: 212 tcggtgatctgatgg 226
| ||||| |||||||
Sbjct: 196 ttggtgacctgatgg 210
>gb|BU967680.1|BU967680 HB05B05r BC Hordeum vulgare subsp. vulgare cDNA clone HB05B05
5-PRIME, mRNA sequence
Length = 336
Score = 46.1 bits (23), Expect = 0.001
Identities = 89/111 (80%)
Strand = Plus / Plus
Query: 116 actcgcaggtcaacgacgaggagcagtgggcgctcaattataagctgctgaaggctgctg 175
|||| ||||||| |||||||||||||||||| |||| |||| |||| |||||| | |
Sbjct: 20 actcccaggtcatggacgaggagcagtgggcggtcaactatagagtgctcaaggctacgg 79
Query: 176 gtctgtttgcgggatccatcttcctgatgcggaacttcggtgatctgatgg 226
| | ||||| ||||| ||||| ||||||| | ||| ||||| |||||||
Sbjct: 80 ggatttttgctggatctatctttttgatgcgcacctttggtgacctgatgg 130
>gb|BU967714.1|BU967714 HB05C19r BC Hordeum vulgare subsp. vulgare cDNA clone HB05C19
5-PRIME, mRNA sequence
Length = 336
Score = 46.1 bits (23), Expect = 0.001
Identities = 89/111 (80%)
Strand = Plus / Plus
Query: 116 actcgcaggtcaacgacgaggagcagtgggcgctcaattataagctgctgaaggctgctg 175
|||| ||||||| |||||||||||||||||| |||| |||| |||| |||||| | |
Sbjct: 20 actcccaggtcatggacgaggagcagtgggcggtcaactatagagtgctcaaggctacgg 79
Query: 176 gtctgtttgcgggatccatcttcctgatgcggaacttcggtgatctgatgg 226
| | ||||| ||||| ||||| ||||||| | ||| ||||| |||||||
Sbjct: 80 ggatttttgctggatctatctttttgatgcgcacctttggtgacctgatgg 130
>gb|BF624746.3|BF624746 HVSMEa0017K03f Hordeum vulgare seedling shoot EST library
HVcDNA0001 (Cold stress) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEa0017K03f, mRNA sequence
Length = 762
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 149 gatggcggcgtcgacggcggtgg 171
>gb|BF620317.2|BF620317 HVSMEc0019G24f Hordeum vulgare seedling shoot EST library
HVcDNA0003 (Etiolated and unstressed) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEc0019G24f, mRNA sequence
Length = 677
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 138 gatggcggcgtcgacggcggtgg 160
>gb|BG365541.1|BG365541 HVSMEi0003C04f Hordeum vulgare 20 DAP spike EST library HVcDNA0010
(20 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEi0003C04f, mRNA sequence
Length = 763
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 144 gatggcggcgtcgacggcggtgg 166
>gb|BG343418.2|BG343418 HVSMEg0005L07f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0005L07f, mRNA sequence
Length = 1000
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 146 gatggcggcgtcgacggcggtgg 168
>gb|BF267415.3|BF267415 HV_CEa0017N20f Hordeum vulgare seedling green leaf EST library
HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp.
vulgare cDNA clone HV_CEa0017N20f, mRNA sequence
Length = 524
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 127 gatggcggcgtcgacggcggtgg 149
>gb|AV917010.1|AV917010 AV917010 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags20h03 5', mRNA sequence
Length = 562
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 170 gatggcggcgtcgacggcggtgg 192
>gb|BQ466225.1|BQ466225 HT01P02T HT Hordeum vulgare subsp. vulgare cDNA clone HT01P02
5-PRIME, mRNA sequence
Length = 658
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 146 gatggcggcgtcgacggcggtgg 168
>gb|BM099943.2|BM099943 EBes01_SQ004_L13_R embryo sac, 4-6 DPA, no treatment, cv Optic,
EBes01 Hordeum vulgare subsp. vulgare cDNA clone
EBes01_SQ004_L13 5', mRNA sequence
Length = 325
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 162 gatggcggcgtcgacggcggtgg 184
>gb|BM100012.2|BM100012 EBes01_SQ004_O13_R embryo sac, 4-6 DPA, no treatment, cv Optic,
EBes01 Hordeum vulgare subsp. vulgare cDNA clone
EBes01_SQ004_O13 5', mRNA sequence
Length = 374
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 153 gatggcggcgtcgacggcggtgg 175
>gb|BQ753630.1|BQ753630 EBan01_SQ004_M20_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ004_M20 5', mRNA sequence
Length = 473
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 134 gatggcggcgtcgacggcggtgg 156
>gb|BU977443.1|BU977443 HA11H02r HA Hordeum vulgare subsp. vulgare cDNA clone HA11H02
5-PRIME, mRNA sequence
Length = 563
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 161 gatggcggcgtcgacggcggtgg 183
>gb|BU996284.1|BU996284 HM13B23r HM Hordeum vulgare subsp. vulgare cDNA clone HM13B23
5-PRIME, mRNA sequence
Length = 663
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 61 gatggcggcgtcgacggcggtgg 83
>gb|BU996575.1|BU996575 HM14A23r HM Hordeum vulgare subsp. vulgare cDNA clone HM14A23
5-PRIME, mRNA sequence
Length = 641
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 60 gatggcggcgtcgacggcggtgg 82
>gb|BU996680.1|BU996680 HM14G10r HM Hordeum vulgare subsp. vulgare cDNA clone HM14G10
5-PRIME, mRNA sequence
Length = 619
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 61 gatggcggcgtcgacggcggtgg 83
>gb|CA011698.1|CA011698 HT03E22r HT Hordeum vulgare subsp. vulgare cDNA clone HT03E22
5-PRIME, mRNA sequence
Length = 406
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 154 gatggcggcgtcgacggcggtgg 176
>gb|CA018161.1|CA018161 HV07L15r HV Hordeum vulgare subsp. vulgare cDNA clone HV07L15
5-PRIME, mRNA sequence
Length = 598
Score = 38.2 bits (19), Expect = 0.28
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 72 gatggcggcgtcgtcggcggtgg 94
||||||||||||| |||||||||
Sbjct: 157 gatggcggcgtcgacggcggtgg 179
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 52,264
Number of Sequences: 312970
Number of extensions: 52264
Number of successful extensions: 17268
Number of sequences better than 0.5: 49
Number of HSP's better than 0.5 without gapping: 49
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17219
Number of HSP's gapped (non-prelim): 49
length of query: 531
length of database: 175,134,539
effective HSP length: 19
effective length of query: 512
effective length of database: 169,188,109
effective search space: 86624311808
effective search space used: 86624311808
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)