BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2161272.2.19
(1410 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BQ468475.1|BQ468475 HM01F21T HM Hordeum vulgare subsp. v... 170 8e-041
gb|BQ469137.1|BQ469137 HM03I08r HM Hordeum vulgare subsp. v... 170 8e-041
gb|CB883976.1|CB883976 HM06N05r HM Hordeum vulgare subsp. v... 170 8e-041
gb|CB884030.1|CB884030 HM10H05r HM Hordeum vulgare subsp. v... 170 8e-041
gb|CB884057.1|CB884057 HM12C11r HM Hordeum vulgare subsp. v... 170 8e-041
gb|CB884040.1|CB884040 HM11B07r HM Hordeum vulgare subsp. v... 149 3e-034
gb|BQ661443.1|BQ661443 HM03I08u HM Hordeum vulgare subsp. v... 133 2e-029
gb|CB881625.1|CB881625 HM10G06w HM Hordeum vulgare subsp. v... 133 2e-029
gb|CB880524.1|CB880524 HM06N05w HM Hordeum vulgare subsp. v... 125 4e-027
gb|BQ764067.1|BQ764067 EBro03_SQ006_N05_R root, 3 week, wat... 123 2e-026
gb|BF622288.3|BF622288 HVSMEa0002I16f Hordeum vulgare seedl... 100 2e-019
gb|CB881506.1|CB881506 HM10A08w HM Hordeum vulgare subsp. v... 98 1e-018
gb|BE454367.2|BE454367 HVSMEh0093N18f Hordeum vulgare 5-45 ... 96 4e-018
gb|BI960089.1|BI960089 HVSMEn0023C15f Hordeum vulgare rachi... 90 2e-016
gb|BE060246.3|BE060246 HVSMEg0011L08f Hordeum vulgare pre-a... 90 2e-016
gb|BI957582.1|BI957582 HVSMEn0010D14f Hordeum vulgare rachi... 88 9e-016
gb|BM372935.2|BM372935 EBma04_SQ002_H04_R maternal, 10 DPA,... 88 9e-016
gb|CB882163.1|CB882163 HL01B01w HL Hordeum vulgare subsp. v... 88 9e-016
gb|CK122346.1|CK122346 BES1824102p12 BES1824 Hordeum vulgar... 88 9e-016
gb|CK125696.1|CK125696 BES1824110b08 BES1824 Hordeum vulgar... 86 4e-015
gb|BI949344.1|BI949344 HVSMEl0013G22f Hordeum vulgare spike... 84 1e-014
gb|BQ458429.1|BQ458429 HA05E07r HA Hordeum vulgare subsp. v... 84 1e-014
gb|BU981055.1|BU981055 HA22I03r HA Hordeum vulgare subsp. v... 84 1e-014
gb|BU981183.1|BU981183 HA22N23r HA Hordeum vulgare subsp. v... 84 1e-014
gb|BU981754.1|BU981754 HA24I17r HA Hordeum vulgare subsp. v... 84 1e-014
gb|CV054003.1|CV054003 BNEL105f8 Barley EST endosperm libra... 84 1e-014
gb|CV054400.1|CV054400 BNEL10B12 Barley EST endosperm libra... 84 1e-014
gb|CV060611.1|CV060611 BNEL5B4 Barley EST endosperm library... 84 1e-014
gb|CV060955.1|CV060955 BNEL63c5 Barley EST endosperm librar... 84 1e-014
gb|CV061225.1|CV061225 BNEL66d10 Barley EST endosperm libra... 84 1e-014
gb|CV061235.1|CV061235 BNEL66d9 Barley EST endosperm librar... 84 1e-014
gb|CV063217.1|CV063217 BNEL87h3 Barley EST endosperm librar... 84 1e-014
gb|CV063456.1|CV063456 BNEL8E2 Barley EST endosperm library... 84 1e-014
gb|CV063939.1|CV063939 BNEL94h5 Barley EST endosperm librar... 84 1e-014
gb|BG310251.1|BG310251 HVSMEc0016K12f Hordeum vulgare seedl... 80 2e-013
gb|CW512145.1|CW512145 ToNAR_Morex_118b Morex Exon trapped ... 78 9e-013
gb|BF628930.2|BF628930 HVSMEb0009C23f Hordeum vulgare seedl... 78 9e-013
gb|AV923254.1|AV923254 AV923254 K. Sato unpublished cDNA li... 78 9e-013
gb|CA022237.1|CA022237 HZ42I19r HZ Hordeum vulgare subsp. v... 78 9e-013
gb|CA023986.1|CA023986 HZ48A15r HZ Hordeum vulgare subsp. v... 78 9e-013
gb|CV054086.1|CV054086 BNEL106e9 Barley EST endosperm libra... 76 4e-012
gb|BQ764220.1|BQ764220 EBan01_SQ005_P04_R anther, yellow st... 70 2e-010
gb|BQ764421.1|BQ764421 EBan01_SQ005_G21_R anther, yellow st... 70 2e-010
gb|BQ767787.1|BQ767787 EBro08_SQ009_H22_R root, 3 week, dro... 70 2e-010
gb|BU995044.1|BU995044 HM09A07r HM Hordeum vulgare subsp. v... 70 2e-010
gb|BI956468.1|BI956468 HVSMEn0003I18f Hordeum vulgare rachi... 68 9e-010
gb|AL507275.1|AL507275 AL507275 Hordeum vulgare Barke devel... 66 3e-009
gb|BF618493.2|BF618493 HVSMEc0005N13f Hordeum vulgare seedl... 66 3e-009
gb|BI956518.1|BI956518 HVSMEn0003O09f Hordeum vulgare rachi... 66 3e-009
gb|BI957183.1|BI957183 HVSMEn0007P24f Hordeum vulgare rachi... 66 3e-009
gb|BI957226.1|BI957226 HVSMEn0008D17f Hordeum vulgare rachi... 66 3e-009
gb|BI957603.1|BI957603 HVSMEn0010F11f Hordeum vulgare rachi... 66 3e-009
gb|BI958784.1|BI958784 HVSMEn0016J13f Hordeum vulgare rachi... 66 3e-009
gb|BI958795.1|BI958795 HVSMEn0016K11f Hordeum vulgare rachi... 66 3e-009
gb|BI959138.1|BI959138 HVSMEn0018F10f Hordeum vulgare rachi... 66 3e-009
gb|BI959353.1|BI959353 HVSMEn0019F12f Hordeum vulgare rachi... 66 3e-009
gb|BI959378.1|BI959378 HVSMEn0019H04f Hordeum vulgare rachi... 66 3e-009
gb|BI959654.1|BI959654 HVSMEn0020K03f Hordeum vulgare rachi... 66 3e-009
gb|BI959698.1|BI959698 HVSMEn0020N13f Hordeum vulgare rachi... 66 3e-009
gb|BI959720.1|BI959720 HVSMEn0020P05f Hordeum vulgare rachi... 66 3e-009
gb|BI959771.1|BI959771 HVSMEn0021G03f Hordeum vulgare rachi... 66 3e-009
gb|BI960458.1|BI960458 HVSMEn0024K16f Hordeum vulgare rachi... 66 3e-009
gb|BE196421.3|BE196421 HVSMEh0092D24f Hordeum vulgare 5-45 ... 66 3e-009
gb|BE603113.3|BE603113 HVSMEh0101P24f Hordeum vulgare 5-45 ... 66 3e-009
gb|BG365461.2|BG365461 HVSMEi0002M09f Hordeum vulgare 20 DA... 66 3e-009
gb|BG369408.2|BG369408 HVSMEi0024E17f Hordeum vulgare 20 DA... 66 3e-009
gb|BQ469285.1|BQ469285 HM03P13r HM Hordeum vulgare subsp. v... 66 3e-009
gb|BM097618.2|BM097618 EBem04_SQ002_D15_R embryo, 12 DPA, n... 66 3e-009
gb|BQ758707.1|BQ758707 EBma07_SQ002_G16_R maternal, 21 DPA,... 66 3e-009
gb|BU993991.1|BU993991 HM05E17r HM Hordeum vulgare subsp. v... 66 3e-009
gb|BU995090.1|BU995090 HM09C23r HM Hordeum vulgare subsp. v... 66 3e-009
gb|CA022206.1|CA022206 HZ42H09r HZ Hordeum vulgare subsp. v... 66 3e-009
gb|CK122095.1|CK122095 BES1824101g21 BES1824 Hordeum vulgar... 66 3e-009
gb|BQ459628.1|BQ459628 HA08J01r HA Hordeum vulgare subsp. v... 64 1e-008
gb|BE230894.2|BE230894 HVSMEg0001I02f Hordeum vulgare pre-a... 62 5e-008
gb|BQ753409.1|BQ753409 EBan01_SQ004_D03_R anther, yellow st... 62 5e-008
gb|BQ753618.1|BQ753618 EBan01_SQ004_M07_R anther, yellow st... 62 5e-008
gb|BU967134.1|BU967134 HB03G05r BC Hordeum vulgare subsp. v... 62 5e-008
gb|BF256653.2|BF256653 HVSMEf0010J19f Hordeum vulgare seedl... 60 2e-007
gb|BF257516.2|BF257516 HVSMEf0013C01f Hordeum vulgare seedl... 60 2e-007
gb|BF259343.2|BF259343 HVSMEf0019F11f Hordeum vulgare seedl... 60 2e-007
gb|BI959328.1|BI959328 HVSMEn0019E09f Hordeum vulgare rachi... 60 2e-007
gb|BI960393.1|BI960393 HVSMEn0024H07f Hordeum vulgare rachi... 60 2e-007
gb|BU978694.1|BU978694 HA14A06r HA Hordeum vulgare subsp. v... 60 2e-007
gb|CA018598.1|CA018598 HV09B16r HV Hordeum vulgare subsp. v... 60 2e-007
gb|CA019202.1|CA019202 HV11D04r HV Hordeum vulgare subsp. v... 60 2e-007
gb|CA019796.1|CA019796 HV13D05r HV Hordeum vulgare subsp. v... 60 2e-007
gb|CA019997.1|CA019997 HV14A15r HV Hordeum vulgare subsp. v... 60 2e-007
gb|CA031744.1|CA031744 HX11A03r HX Hordeum vulgare subsp. v... 60 2e-007
gb|CB882255.1|CB882255 HL01F14w HL Hordeum vulgare subsp. v... 60 2e-007
gb|CB882446.1|CB882446 HL01O04w HL Hordeum vulgare subsp. v... 60 2e-007
gb|CK122737.1|CK122737 BES1824105j22 BES1824 Hordeum vulgar... 60 2e-007
gb|CK123980.1|CK123980 BES1824106f16 BES1824 Hordeum vulgar... 60 2e-007
gb|BF254126.2|BF254126 HVSMEf0003B13f Hordeum vulgare seedl... 58 8e-007
gb|BG368652.1|BG368652 HVSMEi0020B24f Hordeum vulgare 20 DA... 58 8e-007
gb|BI954215.1|BI954215 HVSMEm0016K09f Hordeum vulgare green... 58 8e-007
gb|BE193294.3|BE193294 HVSMEh0080H17f Hordeum vulgare 5-45 ... 58 8e-007
gb|BE193443.3|BE193443 HVSMEh0081A10f Hordeum vulgare 5-45 ... 58 8e-007
gb|BG367014.2|BG367014 HVSMEi0009N03f Hordeum vulgare 20 DA... 58 8e-007
gb|BG367966.2|BG367966 HVSMEi0015B12f Hordeum vulgare 20 DA... 58 8e-007
gb|BG368109.2|BG368109 HVSMEi0015L12f Hordeum vulgare 20 DA... 58 8e-007
gb|BG368126.2|BG368126 HVSMEi0015M21f Hordeum vulgare 20 DA... 58 8e-007
gb|BG368897.2|BG368897 HVSMEi0021D09f Hordeum vulgare 20 DA... 58 8e-007
gb|BG369955.2|BG369955 HVSMEi0026K23f Hordeum vulgare 20 DA... 58 8e-007
gb|BQ465138.1|BQ465138 HU02M06r HU Hordeum vulgare subsp. v... 58 8e-007
gb|BU980194.1|BU980194 HA18P06r HA Hordeum vulgare subsp. v... 58 8e-007
gb|BU983094.1|BU983094 HA28I14r HA Hordeum vulgare subsp. v... 58 8e-007
gb|CA004554.1|CA004554 HS17P08r HS Hordeum vulgare subsp. v... 58 8e-007
gb|CA004842.1|CA004842 HS18N14r HS Hordeum vulgare subsp. v... 58 8e-007
gb|CK124612.1|CK124612 BES1824109m10 BES1824 Hordeum vulgar... 58 8e-007
gb|BI956858.1|BI956858 HVSMEn0005K24f Hordeum vulgare rachi... 56 3e-006
gb|BI957249.1|BI957249 HVSMEn0008G13f Hordeum vulgare rachi... 56 3e-006
gb|BE421427.1|BE421427 HWM009.B12 ITEC HWM Barley Leaf Libr... 54 1e-005
gb|BG299356.2|BG299356 HVSMEa0019J09f Hordeum vulgare seedl... 54 1e-005
gb|BI956772.1|BI956772 HVSMEn0005E06f Hordeum vulgare rachi... 54 1e-005
gb|BG416780.1|BG416780 HVSMEk0014H23f Hordeum vulgare testa... 54 1e-005
gb|BI958420.1|BI958420 HVSMEn0014O10f Hordeum vulgare rachi... 54 1e-005
gb|BI959812.1|BI959812 HVSMEn0021L03f Hordeum vulgare rachi... 54 1e-005
gb|BF260026.3|BF260026 HVSMEf0020O13f Hordeum vulgare seedl... 54 1e-005
gb|BF260322.3|BF260322 HVSMEf0021L02f Hordeum vulgare seedl... 54 1e-005
gb|AV928430.1|AV928430 AV928430 K. Sato unpublished cDNA li... 54 1e-005
gb|BJ453165.1|BJ453165 BJ453165 K. Sato unpublished cDNA li... 54 1e-005
gb|BJ460714.1|BJ460714 BJ460714 K. Sato unpublished cDNA li... 54 1e-005
gb|BJ467335.1|BJ467335 BJ467335 K. Sato unpublished cDNA li... 54 1e-005
gb|BQ467895.1|BQ467895 HR01E04r HR Hordeum vulgare subsp. v... 54 1e-005
gb|BQ662029.1|BQ662029 HR01E04u HR Hordeum vulgare subsp. v... 54 1e-005
gb|BM372620.2|BM372620 EBpi05_SQ003_H14_R pistil, 8 DPA, no... 54 1e-005
gb|BQ753385.1|BQ753385 EBan01_SQ004_C01_R anther, yellow st... 54 1e-005
gb|BQ753440.1|BQ753440 EBan01_SQ004_E11_R anther, yellow st... 54 1e-005
gb|BQ767036.1|BQ767036 EBro08_SQ007_G24_R root, 3 week, dro... 54 1e-005
gb|BQ767806.1|BQ767806 EBro08_SQ009_L19_R root, 3 week, dro... 54 1e-005
gb|CA001233.1|CA001233 HS18N14u HS Hordeum vulgare subsp. v... 54 1e-005
gb|CA001449.1|CA001449 HS17P08u HS Hordeum vulgare subsp. v... 54 1e-005
gb|CK124171.1|CK124171 BES1824107e17 BES1824 Hordeum vulgar... 54 1e-005
gb|BF626539.2|BF626539 HVSMEa0018K23f Hordeum vulgare seedl... 52 5e-005
gb|BQ765573.1|BQ765573 EBro03_SQ007_F17_R root, 3 week, wat... 52 5e-005
gb|BG365226.2|BG365226 HVSMEi0001O04f Hordeum vulgare 20 DA... 50 2e-004
gb|BQ661556.1|BQ661556 HM03P13u HM Hordeum vulgare subsp. v... 50 2e-004
gb|BM097179.2|BM097179 EBpi07_SQ002_K14_R pistil, 12 DPA, n... 50 2e-004
gb|BQ759881.1|BQ759881 EBpi05_SQ004_P16_R pistil, 8 DPA, no... 50 2e-004
gb|BU968145.1|BU968145 HB06J03r BC Hordeum vulgare subsp. v... 50 2e-004
gb|BU984183.1|BU984183 HF03D17r HF Hordeum vulgare subsp. v... 50 2e-004
gb|BU986289.1|BU986289 HF11E17r HF Hordeum vulgare subsp. v... 50 2e-004
gb|CB880652.1|CB880652 HM07E17w HM Hordeum vulgare subsp. v... 50 2e-004
gb|CB881234.1|CB881234 HM09C23w HM Hordeum vulgare subsp. v... 50 2e-004
gb|AL509792.1|AL509792 AL509792 Hordeum vulgare Barke devel... 46 0.003
gb|BU978858.1|BU978858 HA14H15r HA Hordeum vulgare subsp. v... 46 0.003
gb|BF253787.2|BF253787 HVSMEf0002C01f Hordeum vulgare seedl... 44 0.012
gb|AV917139.1|AV917139 AV917139 K. Sato unpublished cDNA li... 44 0.012
gb|BQ470849.1|BQ470849 HX04D14r HX Hordeum vulgare subsp. v... 44 0.012
gb|BQ665573.1|BQ665573 HX04D14u HX Hordeum vulgare subsp. v... 44 0.012
gb|AL504600.1|AL504600 AL504600 Hordeum vulgare Barke roots... 42 0.049
gb|BG300504.2|BG300504 HVSMEb0017E15f Hordeum vulgare seedl... 42 0.049
gb|BU983370.1|BU983370 HA29H20r HA Hordeum vulgare subsp. v... 42 0.049
gb|CA018998.1|CA018998 HV10G08r HV Hordeum vulgare subsp. v... 42 0.049
gb|CA019031.1|CA019031 HV10I11r HV Hordeum vulgare subsp. v... 42 0.049
gb|AV917082.1|AV917082 AV917082 K. Sato unpublished cDNA li... 40 0.19
gb|BQ760850.1|BQ760850 EBro03_SQ003_K11_R root, 3 week, wat... 40 0.19
>gb|BQ468475.1|BQ468475 HM01F21T HM Hordeum vulgare subsp. vulgare cDNA clone HM01F21
5-PRIME, mRNA sequence
Length = 650
Score = 170 bits (86), Expect = 8e-041
Identities = 185/218 (84%)
Strand = Plus / Minus
Query: 1062 acctcgtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgcc 1121
||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||| ||
Sbjct: 339 acctcgtagcaggagccgcatcccttgccgtccttgaagatggggatgttgccgcaggcg 280
Query: 1122 gtcatgccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtca 1181
|||||||| ||||||| | |||||||||| ||||||||||||||| |||||||||||
Sbjct: 279 atcatgccgttgtagggagcaaggttcacgtccttgatcccgcacgcgccgccgttgtct 220
Query: 1182 ggagcgccggcaccgttgggctgaccgtaccaggtggccctagcggtgagccacttgccg 1241
| ||||| ||| ||| || ||||||||||||||| | |||| | ||| || |
Sbjct: 219 ttggggccggagccggtggccttgccgtaccaggtggccttggcgggggtccagttcatg 160
Query: 1242 ttgtagttggtggtgatgttggggccgggtggcacctt 1279
|||||||||||||||||||||||||| |||||||||||
Sbjct: 159 ttgtagttggtggtgatgttggggcccggtggcacctt 122
Score = 54.0 bits (27), Expect = 1e-005
Identities = 57/67 (85%)
Strand = Plus / Minus
Query: 947 gccgaaggccttgccgctcaagtcgaagtggtagggagcgataggctcgtagttcatgtc 1006
|||||||||||||||| || ||| | |||||| || ||||| |||||||||||| ||||
Sbjct: 454 gccgaaggccttgccggacaggtcaatgtggtacggcgcgatgggctcgtagttcttgtc 395
Query: 1007 agtgatg 1013
||||||
Sbjct: 394 ggtgatg 388
Score = 50.1 bits (25), Expect = 2e-004
Identities = 55/65 (84%)
Strand = Plus / Minus
Query: 756 tccatcagcacgatgtcgccgtcgtccgccacatacttcaccagcacggccaggtagttg 815
|||||| ||||||||||||||||||| || || |||| || || | ||||||||||||
Sbjct: 645 tccatctgcacgatgtcgccgtcgtcggcgacgaacttgacgagtatggccaggtagttt 586
Query: 816 gggtt 820
|||||
Sbjct: 585 gggtt 581
>gb|BQ469137.1|BQ469137 HM03I08r HM Hordeum vulgare subsp. vulgare cDNA clone HM03I08
5-PRIME, mRNA sequence
Length = 616
Score = 170 bits (86), Expect = 8e-041
Identities = 185/218 (84%)
Strand = Plus / Minus
Query: 1062 acctcgtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgcc 1121
||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||| ||
Sbjct: 349 acctcgtagcaggagccgcatcccttgccgtccttgaagatggggatgttgccgcaggcg 290
Query: 1122 gtcatgccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtca 1181
|||||||| ||||||| | |||||||||| ||||||||||||||| |||||||||||
Sbjct: 289 atcatgccgttgtagggagcaaggttcacgtccttgatcccgcacgcgccgccgttgtct 230
Query: 1182 ggagcgccggcaccgttgggctgaccgtaccaggtggccctagcggtgagccacttgccg 1241
| ||||| ||| ||| || ||||||||||||||| | |||| | ||| || |
Sbjct: 229 ttggggccggagccggtggccttgccgtaccaggtggccttggcgggggtccagttcatg 170
Query: 1242 ttgtagttggtggtgatgttggggccgggtggcacctt 1279
|||||||||||||||||||||||||| |||||||||||
Sbjct: 169 ttgtagttggtggtgatgttggggcccggtggcacctt 132
Score = 54.0 bits (27), Expect = 1e-005
Identities = 57/67 (85%)
Strand = Plus / Minus
Query: 947 gccgaaggccttgccgctcaagtcgaagtggtagggagcgataggctcgtagttcatgtc 1006
|||||||||||||||| || ||| | |||||| || ||||| |||||||||||| ||||
Sbjct: 464 gccgaaggccttgccggacaggtcaatgtggtacggcgcgatgggctcgtagttcttgtc 405
Query: 1007 agtgatg 1013
||||||
Sbjct: 404 ggtgatg 398
>gb|CB883976.1|CB883976 HM06N05r HM Hordeum vulgare subsp. vulgare cDNA clone HM06N05
5-PRIME, mRNA sequence
Length = 616
Score = 170 bits (86), Expect = 8e-041
Identities = 185/218 (84%)
Strand = Plus / Minus
Query: 1062 acctcgtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgcc 1121
||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||| ||
Sbjct: 318 acctcgtagcaggagccgcatcccttgccgtccttgaagatggggatgttgccgcaggcg 259
Query: 1122 gtcatgccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtca 1181
|||||||| ||||||| | |||||||||| ||||||||||||||| |||||||||||
Sbjct: 258 atcatgccgttgtagggagcaaggttcacgtccttgatcccgcacgcgccgccgttgtct 199
Query: 1182 ggagcgccggcaccgttgggctgaccgtaccaggtggccctagcggtgagccacttgccg 1241
| ||||| ||| ||| || ||||||||||||||| | |||| | ||| || |
Sbjct: 198 ttggggccggagccggtggccttgccgtaccaggtggccttggcgggggtccagttcatg 139
Query: 1242 ttgtagttggtggtgatgttggggccgggtggcacctt 1279
|||||||||||||||||||||||||| |||||||||||
Sbjct: 138 ttgtagttggtggtgatgttggggcccggtggcacctt 101
Score = 54.0 bits (27), Expect = 1e-005
Identities = 57/67 (85%)
Strand = Plus / Minus
Query: 947 gccgaaggccttgccgctcaagtcgaagtggtagggagcgataggctcgtagttcatgtc 1006
|||||||||||||||| || ||| | |||||| || ||||| |||||||||||| ||||
Sbjct: 433 gccgaaggccttgccggacaggtcaatgtggtacggcgcgatgggctcgtagttcttgtc 374
Query: 1007 agtgatg 1013
||||||
Sbjct: 373 ggtgatg 367
Score = 44.1 bits (22), Expect = 0.012
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 764 cacgatgtcgccgtcgtccgccacatacttcaccagcacggccaggtagttggggttgca 823
|||||||||||||||||| || || |||| || || | |||||||||||| ||||| |
Sbjct: 616 cacgatgtcgccgtcgtcggcgacgaacttgacgagtatggccaggtagtttgggttcga 557
Query: 824 gcccttctcgatgtggaa 841
||| |||||| ||||||
Sbjct: 556 gccggtctcgacgtggaa 539
>gb|CB884030.1|CB884030 HM10H05r HM Hordeum vulgare subsp. vulgare cDNA clone HM10H05
5-PRIME, mRNA sequence
Length = 539
Score = 170 bits (86), Expect = 8e-041
Identities = 185/218 (84%)
Strand = Plus / Minus
Query: 1062 acctcgtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgcc 1121
||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||| ||
Sbjct: 318 acctcgtagcaggagccgcatcccttgccgtccttgaagatggggatgttgccgcaggcg 259
Query: 1122 gtcatgccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtca 1181
|||||||| ||||||| | |||||||||| ||||||||||||||| |||||||||||
Sbjct: 258 atcatgccgttgtagggagcaaggttcacgtccttgatcccgcacgcgccgccgttgtct 199
Query: 1182 ggagcgccggcaccgttgggctgaccgtaccaggtggccctagcggtgagccacttgccg 1241
| ||||| ||| ||| || ||||||||||||||| | |||| | ||| || |
Sbjct: 198 ttggggccggagccggtggccttgccgtaccaggtggccttggcgggggtccagttcatg 139
Query: 1242 ttgtagttggtggtgatgttggggccgggtggcacctt 1279
|||||||||||||||||||||||||| |||||||||||
Sbjct: 138 ttgtagttggtggtgatgttggggcccggtggcacctt 101
Score = 54.0 bits (27), Expect = 1e-005
Identities = 57/67 (85%)
Strand = Plus / Minus
Query: 947 gccgaaggccttgccgctcaagtcgaagtggtagggagcgataggctcgtagttcatgtc 1006
|||||||||||||||| || ||| | |||||| || ||||| |||||||||||| ||||
Sbjct: 433 gccgaaggccttgccggacaggtcaatgtggtacggcgcgatgggctcgtagttcttgtc 374
Query: 1007 agtgatg 1013
||||||
Sbjct: 373 ggtgatg 367
>gb|CB884057.1|CB884057 HM12C11r HM Hordeum vulgare subsp. vulgare cDNA clone HM12C11
5-PRIME, mRNA sequence
Length = 539
Score = 170 bits (86), Expect = 8e-041
Identities = 185/218 (84%)
Strand = Plus / Minus
Query: 1062 acctcgtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgcc 1121
||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||| ||
Sbjct: 318 acctcgtagcaggagccgcatcccttgccgtccttgaagatggggatgttgccgcaggcg 259
Query: 1122 gtcatgccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtca 1181
|||||||| ||||||| | |||||||||| ||||||||||||||| |||||||||||
Sbjct: 258 atcatgccgttgtagggagcaaggttcacgtccttgatcccgcacgcgccgccgttgtct 199
Query: 1182 ggagcgccggcaccgttgggctgaccgtaccaggtggccctagcggtgagccacttgccg 1241
| ||||| ||| ||| || ||||||||||||||| | |||| | ||| || |
Sbjct: 198 ttggggccggagccggtggccttgccgtaccaggtggccttggcgggggtccagttcatg 139
Query: 1242 ttgtagttggtggtgatgttggggccgggtggcacctt 1279
|||||||||||||||||||||||||| |||||||||||
Sbjct: 138 ttgtagttggtggtgatgttggggcccggtggcacctt 101
Score = 54.0 bits (27), Expect = 1e-005
Identities = 57/67 (85%)
Strand = Plus / Minus
Query: 947 gccgaaggccttgccgctcaagtcgaagtggtagggagcgataggctcgtagttcatgtc 1006
|||||||||||||||| || ||| | |||||| || ||||| |||||||||||| ||||
Sbjct: 433 gccgaaggccttgccggacaggtcaatgtggtacggcgcgatgggctcgtagttcttgtc 374
Query: 1007 agtgatg 1013
||||||
Sbjct: 373 ggtgatg 367
>gb|CB884040.1|CB884040 HM11B07r HM Hordeum vulgare subsp. vulgare cDNA clone HM11B07
5-PRIME, mRNA sequence
Length = 377
Score = 149 bits (75), Expect = 3e-034
Identities = 184/219 (84%), Gaps = 1/219 (0%)
Strand = Plus / Minus
Query: 1062 acctcgtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgcc 1121
|||| |||||| |||||||| ||||||||||||||||||||||||| ||||||||| ||
Sbjct: 321 acctagtagcaggagccgcatcccttgccgtccttgaagatggggatgttgccgcaggcg 262
Query: 1122 gtcatgccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtca 1181
|||||||| ||||||| | |||||||||| ||||||||||||||| |||||||||||
Sbjct: 261 atcatgccgttgtagggagcaaggttcacgtccttgatcccgcacgcgccgccgttgtct 202
Query: 1182 ggagcgccggcaccgttgggctgaccgtaccaggtggccctagcggtgagccacttgccg 1241
| ||||| ||| ||| || ||||||||||||||| | |||| | ||| || |
Sbjct: 201 ttggggccggagccggtggccttgccgtaccaggtggccttggcgggggtccagttcatg 142
Query: 1242 ttgtagttggtggtgatgttgggg-ccgggtggcacctt 1279
|||||||||||||||||||||||| ||| ||||||||||
Sbjct: 141 ttgtagttggtggtgatgttggggcccgtgtggcacctt 103
>gb|BQ661443.1|BQ661443 HM03I08u HM Hordeum vulgare subsp. vulgare cDNA clone HM03I08
3-PRIME, mRNA sequence
Length = 520
Score = 133 bits (67), Expect = 2e-029
Identities = 118/135 (87%)
Strand = Plus / Plus
Query: 575 gtagacggcatcgggtctccagttcgccgggatgacgtctttggcgatgaccttcttgcc 634
|||||||| ||||| ||||||| || ||||||||||| | |||||||| |||||||||
Sbjct: 222 gtagacggtgtcgggcttccagttggcggggatgacgtcctgggcgatgagcttcttgcc 281
Query: 635 ggactcgctggtgaggcggatggagaaggggcccttgagcgccttggcagtgtccatcct 694
||||||||||||||||||||||||||||||| |||||| ||| ||||| |||| |||
Sbjct: 282 ggactcgctggtgaggcggatggagaagggggccttgatcgcattggcgccgtcccacct 341
Query: 695 ccagatggcgcccca 709
|||||||||||||||
Sbjct: 342 ccagatggcgcccca 356
Score = 54.0 bits (27), Expect = 1e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 747 tcctggatttccatcagcacgatgtcgccgtcgtccgccacatacttcaccagcacggcc 806
||||| || |||||| ||||||||||||||||||| || || |||| || || | ||||
Sbjct: 397 tcctgaatctccatctgcacgatgtcgccgtcgtcggcgacgaacttgacgagtatggcc 456
Query: 807 aggtagttggggttgcagcccttctcgatgtggaa 841
|||||||| ||||| |||| |||||| ||||||
Sbjct: 457 aggtagtttgggttcgagccggtctcgacgtggaa 491
>gb|CB881625.1|CB881625 HM10G06w HM Hordeum vulgare subsp. vulgare cDNA clone HM10G06
3-PRIME, mRNA sequence
Length = 588
Score = 133 bits (67), Expect = 2e-029
Identities = 118/135 (87%)
Strand = Plus / Plus
Query: 575 gtagacggcatcgggtctccagttcgccgggatgacgtctttggcgatgaccttcttgcc 634
|||||||| ||||| ||||||| || ||||||||||| | |||||||| |||||||||
Sbjct: 223 gtagacggtgtcgggcttccagttggcggggatgacgtcctgggcgatgagcttcttgcc 282
Query: 635 ggactcgctggtgaggcggatggagaaggggcccttgagcgccttggcagtgtccatcct 694
||||||||||||||||||||||||||||||| |||||| ||| ||||| |||| |||
Sbjct: 283 ggactcgctggtgaggcggatggagaagggggccttgatcgcattggcgccgtcccacct 342
Query: 695 ccagatggcgcccca 709
|||||||||||||||
Sbjct: 343 ccagatggcgcccca 357
Score = 54.0 bits (27), Expect = 1e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 747 tcctggatttccatcagcacgatgtcgccgtcgtccgccacatacttcaccagcacggcc 806
||||| || |||||| ||||||||||||||||||| || || |||| || || | ||||
Sbjct: 398 tcctgaatctccatctgcacgatgtcgccgtcgtcggcgacgaacttgacgagtatggcc 457
Query: 807 aggtagttggggttgcagcccttctcgatgtggaa 841
|||||||| ||||| |||| |||||| ||||||
Sbjct: 458 aggtagtttgggttcgagccggtctcgacgtggaa 492
>gb|CB880524.1|CB880524 HM06N05w HM Hordeum vulgare subsp. vulgare cDNA clone HM06N05
3-PRIME, mRNA sequence
Length = 545
Score = 125 bits (63), Expect = 4e-027
Identities = 117/135 (86%)
Strand = Plus / Plus
Query: 575 gtagacggcatcgggtctccagttcgccgggatgacgtctttggcgatgaccttcttgcc 634
|||||||| ||||| ||||||| || ||||||||||| | |||||||| |||||||||
Sbjct: 233 gtagacggtgtcgggcttccagttggcggggatgacgtcctgggcgatgagcttcttgcc 292
Query: 635 ggactcgctggtgaggcggatggagaaggggcccttgagcgccttggcagtgtccatcct 694
|||||||||||||||||||||||| |||||| |||||| ||| ||||| |||| |||
Sbjct: 293 ggactcgctggtgaggcggatggaaaagggggccttgatcgcattggcgccgtcccacct 352
Query: 695 ccagatggcgcccca 709
|||||||||||||||
Sbjct: 353 ccagatggcgcccca 367
Score = 54.0 bits (27), Expect = 1e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 747 tcctggatttccatcagcacgatgtcgccgtcgtccgccacatacttcaccagcacggcc 806
||||| || |||||| ||||||||||||||||||| || || |||| || || | ||||
Sbjct: 408 tcctgaatctccatctgcacgatgtcgccgtcgtcggcgacgaacttgacgagtatggcc 467
Query: 807 aggtagttggggttgcagcccttctcgatgtggaa 841
|||||||| ||||| |||| |||||| ||||||
Sbjct: 468 aggtagtttgggttcgagccggtctcgacgtggaa 502
>gb|BQ764067.1|BQ764067 EBro03_SQ006_N05_R root, 3 week, waterlogged, cv Optic, EBro03
Hordeum vulgare subsp. vulgare cDNA clone
EBro03_SQ006_N05 5', mRNA sequence
Length = 625
Score = 123 bits (62), Expect = 2e-026
Identities = 101/114 (88%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||| |||||||||||||||||||| || |||||||||||| ||||||
Sbjct: 416 gtagcaggagccgcatcccttgccgtccttgaagatcggctcgttgccgcacgacgtcat 357
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| || || |||| ||||||||||||||||||| ||||||||| || ||||||||
Sbjct: 356 ggcgttgaagggcggcaggttcacgttcttgaacccgcacgcgccaccgttgtc 303
Score = 46.1 bits (23), Expect = 0.003
Identities = 56/67 (83%)
Strand = Plus / Minus
Query: 947 gccgaaggccttgccgctcaagtcgaagtggtagggagcgataggctcgtagttcatgtc 1006
||||||||| ||||||| | ||||||||||||| | |||| || | ||||||||||||
Sbjct: 542 gccgaaggcagtgccgctgaggtcgaagtggtagcgggcgaccgggtagtagttcatgtc 483
Query: 1007 agtgatg 1013
||||||
Sbjct: 482 ggtgatg 476
>gb|BF622288.3|BF622288 HVSMEa0002I16f Hordeum vulgare seedling shoot EST library HVcDNA0001
(Cold stress) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEa0002I16f, mRNA sequence
Length = 851
Score = 99.6 bits (50), Expect = 2e-019
Identities = 98/114 (85%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || |||||||||| | |||||
Sbjct: 205 gtagcaggagccgcagcccttgccgtccttgaagagcggctcgttgccgcaggaggtcat 146
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| || | ||||||||||||| |||||||||| |||||| || |||||||||||
Sbjct: 145 ggcggagaagggtggcaggttgacgttcttgaacccgcaggcgccgccgttgtc 92
Score = 44.1 bits (22), Expect = 0.012
Identities = 37/42 (88%)
Strand = Plus / Minus
Query: 628 tcttgccggactcgctggtgaggcggatggagaaggggccct 669
|||||||||||||| |||||| ||| | |||||||||||||
Sbjct: 683 tcttgccggactcgttggtgatgcgcagcgagaaggggccct 642
>gb|CB881506.1|CB881506 HM10A08w HM Hordeum vulgare subsp. vulgare cDNA clone HM10A08
3-PRIME, mRNA sequence
Length = 368
Score = 97.6 bits (49), Expect = 1e-018
Identities = 73/81 (90%)
Strand = Plus / Plus
Query: 592 tccagttcgccgggatgacgtctttggcgatgaccttcttgccggactcgctggtgaggc 651
||||||| || ||||||||||| | |||||||| ||||||||||||||| ||||||||||
Sbjct: 287 tccagttggcggggatgacgtcctgggcgatgagcttcttgccggactccctggtgaggc 346
Query: 652 ggatggagaaggggcccttga 672
||||||| |||||| ||||||
Sbjct: 347 ggatggaaaagggggccttga 367
>gb|BE454367.2|BE454367 HVSMEh0093N18f Hordeum vulgare 5-45 DAP spike EST library HVcDNA0009
(5 to 45 DAP) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEh0093N18f, mRNA sequence
Length = 870
Score = 95.6 bits (48), Expect = 4e-018
Identities = 117/140 (83%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
|||||| | ||||||||| ||| ||||||||| ||||||| | | |||||||||||||||
Sbjct: 145 gcacccgtgtgaactcgatgtcgatgatgccggagtggcggagcctgtcgttgagcccgg 86
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||||||| || |||||| ||| ||||||| | ||||||||||||||| || | || |
Sbjct: 85 gctttgcgagcctgccgaacgccgtgccgctgaggtcgaagtggtagggcgccaccgggt 26
Query: 994 cgtagttcatgtcagtgatg 1013
|||||||||||| ||||||
Sbjct: 25 agtagttcatgtcggtgatg 6
>gb|BI960089.1|BI960089 HVSMEn0023C15f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0023C15f,
mRNA sequence
Length = 646
Score = 89.7 bits (45), Expect = 2e-016
Identities = 111/133 (83%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
|||||| | ||||||||| ||| ||||||||| ||||||| | | |||||||||||||||
Sbjct: 572 gcacccgtgtgaactcgatgtcgatgatgccggagtggcggagcctgtcgttgagcccgg 513
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||||||| || |||||| ||| ||||||| | ||||||||||||||| || | || |
Sbjct: 512 gctttgcgagcctgccgaacgccgtgccgctgaggtcgaagtggtagggcgccaccgggt 453
Query: 994 cgtagttcatgtc 1006
||||||||||||
Sbjct: 452 agtagttcatgtc 440
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 1054 tgcatctcacctcgtagcatgagccgcagcccttgccgtccttgaa 1099
||||||| | || ||||||||||||||| |||||||||||||||||
Sbjct: 392 tgcatctgatcttgtagcatgagccgcatcccttgccgtccttgaa 347
>gb|BE060246.3|BE060246 HVSMEg0011L08f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0011L08f, mRNA sequence
Length = 544
Score = 89.7 bits (45), Expect = 2e-016
Identities = 111/133 (83%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
|||||| | ||||||||| ||| ||||||||| ||||||| | | |||||||||||||||
Sbjct: 134 gcacccgtgtgaactcgatgtcgatgatgccggagtggcggagcctgtcgttgagcccgg 75
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||||||| || |||||| ||| ||||||| | ||||||||||||||| || | || |
Sbjct: 74 gctttgcgagcctgccgaacgccgtgccgctgaggtcgaagtggtagggcgccaccgggt 15
Query: 994 cgtagttcatgtc 1006
||||||||||||
Sbjct: 14 agtagttcatgtc 2
Score = 54.0 bits (27), Expect = 1e-005
Identities = 60/71 (84%)
Strand = Plus / Minus
Query: 591 ctccagttcgccgggatgacgtctttggcgatgaccttcttgccggactcgctggtgagg 650
|||||||| ||||||||||| | ||||||| || | |||||||||||||| || || |
Sbjct: 423 ctccagttggccgggatgaccttgttggcgacgagcgtcttgccggactcgttgcggatg 364
Query: 651 cggatggagaa 661
|||||||||||
Sbjct: 363 cggatggagaa 353
>gb|BI957582.1|BI957582 HVSMEn0010D14f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0010D14f,
mRNA sequence
Length = 628
Score = 87.7 bits (44), Expect = 9e-016
Identities = 116/140 (82%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
|||||| | ||||||||| ||| ||||||||| ||||||| | | |||||||||||| ||
Sbjct: 574 gcacccgtgtgaactcgatgtcgatgatgccggagtggcggagcctgtcgttgagccggg 515
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||||||| || |||||| ||| ||||| ||| ||||||||||||||| || | || |
Sbjct: 514 gctttgcgagcctgccgaacgccgtgccggtcaggtcgaagtggtagggcgccaccgggt 455
Query: 994 cgtagttcatgtcagtgatg 1013
|||||||||||| ||||||
Sbjct: 454 agtagttcatgtcggtgatg 435
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 1054 tgcatctcacctcgtagcatgagccgcagcccttgccgtccttgaa 1099
||||||| | || ||||||||||||||| |||||||||||||||||
Sbjct: 394 tgcatctgatcttgtagcatgagccgcatcccttgccgtccttgaa 349
>gb|BM372935.2|BM372935 EBma04_SQ002_H04_R maternal, 10 DPA, no treatment, cv Optic, EBma04
Hordeum vulgare subsp. vulgare cDNA clone
EBma04_SQ002_H04 5', mRNA sequence
Length = 612
Score = 87.7 bits (44), Expect = 9e-016
Identities = 116/140 (82%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
|||||| | ||||||||| ||| ||||||||| ||||||| | | |||||||||||||||
Sbjct: 554 gcacccgtgtgaactcgatgtcgatgatgccggagtggcggagcctgtcgttgagcccgg 495
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||||||| || |||||| || ||||||| | ||||||||||||||| || | || |
Sbjct: 494 gctttgcgagcctgccgaacgctgtgccgctgaggtcgaagtggtagggcgccaccgggt 435
Query: 994 cgtagttcatgtcagtgatg 1013
|||||||||||| ||||||
Sbjct: 434 agtagttcatgtcggtgatg 415
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 1054 tgcatctcacctcgtagcatgagccgcagcccttgccgtccttgaa 1099
||||||| | || ||||||||||||||| |||||||||||||||||
Sbjct: 374 tgcatctgatcttgtagcatgagccgcatcccttgccgtccttgaa 329
Score = 40.1 bits (20), Expect = 0.19
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 1187 gccggcaccgttgggctgaccgtaccaggtggccct 1222
|||||| || |||||||| ||||||||||| |||||
Sbjct: 241 gccggcgccattgggctggccgtaccaggtcgccct 206
>gb|CB882163.1|CB882163 HL01B01w HL Hordeum vulgare subsp. vulgare cDNA clone HL01B01
3-PRIME, mRNA sequence
Length = 574
Score = 87.7 bits (44), Expect = 9e-016
Identities = 116/140 (82%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
|||||| | ||||||||| ||| ||||||||| ||||||| | | |||||||||||||||
Sbjct: 568 gcacccgtgtgaactcgatgtcgatgatgccggagtggcggagcctgtcgttgagcccgg 509
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||||||| || |||||| || ||||||| | ||||||||||||||| || | || |
Sbjct: 508 gctttgcgagcctgccgaacgctgtgccgctgaggtcgaagtggtagggcgccaccgggt 449
Query: 994 cgtagttcatgtcagtgatg 1013
|||||||||||| ||||||
Sbjct: 448 agtagttcatgtcggtgatg 429
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 1054 tgcatctcacctcgtagcatgagccgcagcccttgccgtccttgaa 1099
||||||| | || ||||||||||||||| |||||||||||||||||
Sbjct: 388 tgcatctgatcttgtagcatgagccgcatcccttgccgtccttgaa 343
Score = 40.1 bits (20), Expect = 0.19
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 1187 gccggcaccgttgggctgaccgtaccaggtggccct 1222
|||||| || |||||||| ||||||||||| |||||
Sbjct: 255 gccggcgccattgggctggccgtaccaggtcgccct 220
>gb|CK122346.1|CK122346 BES1824102p12 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010P122 5-PRIME, mRNA sequence
Length = 717
Score = 87.7 bits (44), Expect = 9e-016
Identities = 116/140 (82%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
|||||| | ||||||||| ||| ||||||||| ||||||| | | |||||||||||||||
Sbjct: 262 gcacccgtgtgaactcgatgtcgatgatgccggagtggcggagcctgtcgttgagcccgg 203
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||||||| || |||||| || ||||||| | ||||||||||||||| || | || |
Sbjct: 202 gctttgcgagcctgccgaacgctgtgccgctgaggtcgaagtggtagggcgccaccgggt 143
Query: 994 cgtagttcatgtcagtgatg 1013
|||||||||||| ||||||
Sbjct: 142 agtagttcatgtcggtgatg 123
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 1054 tgcatctcacctcgtagcatgagccgcagcccttgccgtccttgaa 1099
||||||| | || ||||||||||||||| |||||||||||||||||
Sbjct: 82 tgcatctgatcttgtagcatgagccgcatcccttgccgtccttgaa 37
Score = 54.0 bits (27), Expect = 1e-005
Identities = 60/71 (84%)
Strand = Plus / Minus
Query: 591 ctccagttcgccgggatgacgtctttggcgatgaccttcttgccggactcgctggtgagg 650
|||||||| ||||||||||| | ||||||| || | |||||||||||||| || || |
Sbjct: 551 ctccagttggccgggatgaccttgttggcgacgagcgtcttgccggactcgttgcggatg 492
Query: 651 cggatggagaa 661
|||||||||||
Sbjct: 491 cggatggagaa 481
>gb|CK125696.1|CK125696 BES1824110b08 BES1824 Hordeum vulgare subsp. vulgare cDNA clone
MPMGp2010B0810 5-PRIME, mRNA sequence
Length = 638
Score = 85.7 bits (43), Expect = 4e-015
Identities = 109/131 (83%)
Strand = Plus / Minus
Query: 883 tgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgggctttgcca 942
||||||||| ||| ||||||||| ||||||| | | |||||||||||||||||||||| |
Sbjct: 495 tgaactcgatgtcgatgatgccggagtggcggagcctgtcgttgagcccgggctttgcga 436
Query: 943 gggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggctcgtagttca 1002
| |||||| || ||||||| | ||||||||||||||| || | || | ||||||||
Sbjct: 435 gcctgccgaacgctgtgccgctgaggtcgaagtggtagggcgccaccgggtagtagttca 376
Query: 1003 tgtcagtgatg 1013
|||| ||||||
Sbjct: 375 tgtcggtgatg 365
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 1054 tgcatctcacctcgtagcatgagccgcagcccttgccgtccttgaa 1099
||||||| | || ||||||||||||||| |||||||||||||||||
Sbjct: 324 tgcatctgatcttgtagcatgagccgcatcccttgccgtccttgaa 279
Score = 40.1 bits (20), Expect = 0.19
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 1187 gccggcaccgttgggctgaccgtaccaggtggccct 1222
|||||| || |||||||| ||||||||||| |||||
Sbjct: 191 gccggcgccattgggctggccgtaccaggtcgccct 156
>gb|BI949344.1|BI949344 HVSMEl0013G22f Hordeum vulgare spike EST library HVcDNA0012 (Fusarium
infected) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEl0013G22f, mRNA sequence
Length = 488
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 247 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 188
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 187 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 134
>gb|BQ458429.1|BQ458429 HA05E07r HA Hordeum vulgare subsp. vulgare cDNA clone HA05E07
5-PRIME, mRNA sequence
Length = 504
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 178 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 119
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 118 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 65
>gb|BU981055.1|BU981055 HA22I03r HA Hordeum vulgare subsp. vulgare cDNA clone HA22I03
5-PRIME, mRNA sequence
Length = 597
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 240 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 181
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 180 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 127
>gb|BU981183.1|BU981183 HA22N23r HA Hordeum vulgare subsp. vulgare cDNA clone HA22N23
5-PRIME, mRNA sequence
Length = 465
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 279 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 220
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 219 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 166
>gb|BU981754.1|BU981754 HA24I17r HA Hordeum vulgare subsp. vulgare cDNA clone HA24I17
5-PRIME, mRNA sequence
Length = 495
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 285 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 226
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 225 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 172
>gb|CV054003.1|CV054003 BNEL105f8 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL105f8 5' similar to Oryza sativa
beta-expansin, mRNA sequence
Length = 702
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 287 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 228
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 227 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 174
>gb|CV054400.1|CV054400 BNEL10B12 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL10B12 5' similar to Oryza sativa
beta-expansin, mRNA sequence
Length = 533
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 287 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 228
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 227 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 174
>gb|CV060611.1|CV060611 BNEL5B4 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL5B4 5' similar to Oryza sativa
beta-expansin, mRNA sequence
Length = 634
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 287 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 228
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 227 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 174
>gb|CV060955.1|CV060955 BNEL63c5 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL63c5 5' similar to Oryza sativa
beta-expansin, mRNA sequence
Length = 634
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 229 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 170
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 169 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 116
>gb|CV061225.1|CV061225 BNEL66d10 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL66d10 5' similar to Oryza sativa
beta-expansin, mRNA sequence
Length = 539
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 285 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 226
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 225 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 172
>gb|CV061235.1|CV061235 BNEL66d9 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL66d9 5' similar to Triticum aestivum
expansin EXPB7 mRNA, complete cds, mRNA sequence
Length = 551
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 287 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 228
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 227 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 174
>gb|CV063217.1|CV063217 BNEL87h3 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL87h3 5' similar to Oryza sativa
beta-expansin, mRNA sequence
Length = 701
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 293 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 234
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 233 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 180
>gb|CV063456.1|CV063456 BNEL8E2 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL8E2 5' similar to Oryza sativa
beta-expansin, mRNA sequence
Length = 546
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 285 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 226
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 225 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 172
>gb|CV063939.1|CV063939 BNEL94h5 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL94h5 5' similar to Oryza sativa
beta-expansin, mRNA sequence
Length = 661
Score = 83.8 bits (42), Expect = 1e-014
Identities = 96/114 (84%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 285 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 226
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | ||||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 225 ggaggagaagggtggcaagttgacgttcttgaacccgcacgcgccgccgttgtc 172
>gb|BG310251.1|BG310251 HVSMEc0016K12f Hordeum vulgare seedling shoot EST library HVcDNA0003
(Etiolated and unstressed) Hordeum vulgare subsp. vulgare
cDNA clone HVSMEc0016K12f, mRNA sequence
Length = 787
Score = 79.8 bits (40), Expect = 2e-013
Identities = 115/140 (82%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
|||||| | |||| |||| ||| ||||||||| |||| || | | |||||||||||||||
Sbjct: 560 gcacccgtgtgaattcgatgtcgatgatgccggagtgccggagcctgtcgttgagcccgg 501
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||||||| || |||||| ||| ||||||| | ||||||||||||||| || | || |
Sbjct: 500 gctttgcgagcctgccgaacgccgtgccgctgaggtcgaagtggtagggcgccaccgggt 441
Query: 994 cgtagttcatgtcagtgatg 1013
|||||||||||| ||||||
Sbjct: 440 agtagttcatgtcggtgatg 421
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 1054 tgcatctcacctcgtagcatgagccgcagcccttgccgtccttgaa 1099
||||||| | || ||||||||||||||| |||||||||||||||||
Sbjct: 380 tgcatctgatcttgtagcatgagccgcatcccttgccgtccttgaa 335
>gb|CW512145.1|CW512145 ToNAR_Morex_118b Morex Exon trapped genomic sequences from PCR
products Hordeum vulgare subsp. vulgare genomic, DNA
sequence
Length = 499
Score = 77.8 bits (39), Expect = 9e-013
Identities = 114/139 (82%)
Strand = Plus / Plus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
||||||| ||||||| || ||| |||||||| ||||||| | ||| |||||||| || |
Sbjct: 38 gcaccctcctgaactggatgtcgatgatgcccgagtggcggagcttctcgttgaggcccg 97
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||| ||||||| |||||||||| ||||||||| ||| |||||||| | |||| || |
Sbjct: 98 acttggccagggcgccgaaggccgtgccgctcaggtcaaagtggtactgggcgaccgggt 157
Query: 994 cgtagttcatgtcagtgat 1012
|||||||||||| |||||
Sbjct: 158 agtagttcatgtcggtgat 176
Score = 60.0 bits (30), Expect = 2e-007
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 1062 acctcgtagcatgagccgcagcccttgccgtccttgaa 1099
|||| |||||| ||||||||||||||||||||||||||
Sbjct: 403 acctggtagcaggagccgcagcccttgccgtccttgaa 440
>gb|BF628930.2|BF628930 HVSMEb0009C23f Hordeum vulgare seedling shoot EST library HVcDNA0002
(Dehydration stress) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEb0009C23f, mRNA sequence
Length = 762
Score = 77.8 bits (39), Expect = 9e-013
Identities = 114/139 (82%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
||||||| ||||||| || ||| |||||||| ||||||| | ||| |||||||| || |
Sbjct: 549 gcaccctcctgaactggatgtcgatgatgcccgagtggcggagcttctcgttgaggcccg 490
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||| ||||||| |||||||||| ||||||||| ||| |||||||| | |||| || |
Sbjct: 489 acttggccagggcgccgaaggccgtgccgctcaggtcaaagtggtactgggcgaccgggt 430
Query: 994 cgtagttcatgtcagtgat 1012
|||||||||||| |||||
Sbjct: 429 agtagttcatgtcggtgat 411
Score = 58.0 bits (29), Expect = 8e-007
Identities = 32/33 (96%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaa 1099
|||||| ||||||||||||||||||||||||||
Sbjct: 356 gtagcaggagccgcagcccttgccgtccttgaa 324
>gb|AV923254.1|AV923254 AV923254 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp. vulgare
cDNA clone basd12g18 5', mRNA sequence
Length = 616
Score = 77.8 bits (39), Expect = 9e-013
Identities = 114/139 (82%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
||||||| ||||||| || ||| |||||||| ||||||| | ||| |||||||| || |
Sbjct: 571 gcaccctcctgaactggatgtcgatgatgcccgagtggcggagcttctcgttgaggcccg 512
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||| ||||||| |||||||||| ||||||||| ||| |||||||| | |||| || |
Sbjct: 511 acttggccagggcgccgaaggccgtgccgctcaggtcaaagtggtactgggcgaccgggt 452
Query: 994 cgtagttcatgtcagtgat 1012
|||||||||||| |||||
Sbjct: 451 agtagttcatgtcggtgat 433
Score = 58.0 bits (29), Expect = 8e-007
Identities = 32/33 (96%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaa 1099
|||||| ||||||||||||||||||||||||||
Sbjct: 378 gtagcaggagccgcagcccttgccgtccttgaa 346
>gb|CA022237.1|CA022237 HZ42I19r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ42I19
5-PRIME, mRNA sequence
Length = 539
Score = 77.8 bits (39), Expect = 9e-013
Identities = 114/139 (82%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
||||||| ||||||| || ||| |||||||| ||||||| | ||| |||||||| || |
Sbjct: 520 gcaccctcctgaactggatgtcgatgatgcccgagtggcggagcttctcgttgaggcccg 461
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||| ||||||| |||||||||| ||||||||| ||| |||||||| | |||| || |
Sbjct: 460 acttggccagggcgccgaaggccgtgccgctcaggtcaaagtggtactgggcgaccgggt 401
Query: 994 cgtagttcatgtcagtgat 1012
|||||||||||| |||||
Sbjct: 400 agtagttcatgtcggtgat 382
Score = 58.0 bits (29), Expect = 8e-007
Identities = 32/33 (96%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaa 1099
|||||| ||||||||||||||||||||||||||
Sbjct: 327 gtagcaggagccgcagcccttgccgtccttgaa 295
>gb|CA023986.1|CA023986 HZ48A15r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ48A15
5-PRIME, mRNA sequence
Length = 584
Score = 77.8 bits (39), Expect = 9e-013
Identities = 114/139 (82%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
||||||| ||||||| || ||| |||||||| ||||||| | ||| |||||||| || |
Sbjct: 569 gcaccctcctgaactggatgtcgatgatgcccgagtggcggagcttctcgttgaggcccg 510
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||| ||||||| |||||||||| ||||||||| ||| |||||||| | |||| || |
Sbjct: 509 acttggccagggcgccgaaggccgtgccgctcaggtcaaagtggtactgggcgaccgggt 450
Query: 994 cgtagttcatgtcagtgat 1012
|||||||||||| |||||
Sbjct: 449 agtagttcatgtcggtgat 431
Score = 58.0 bits (29), Expect = 8e-007
Identities = 32/33 (96%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaa 1099
|||||| ||||||||||||||||||||||||||
Sbjct: 376 gtagcaggagccgcagcccttgccgtccttgaa 344
>gb|CV054086.1|CV054086 BNEL106e9 Barley EST endosperm library Hordeum vulgare subsp. vulgare
cDNA clone BNEL106e9 5' similar to Triticum aestivum
expansin EXPB7 mRNA, complete cds, mRNA sequence
Length = 718
Score = 75.8 bits (38), Expect = 4e-012
Identities = 95/114 (83%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||||||||||||||||||||||| || ||||||||| | |||||
Sbjct: 293 gtagcaggagccgcagcccttgccgtccttgaagagcggttggttgccgcaggaggtcat 234
Query: 1127 gccgctgtagggtggcaggttcacgttcttgatcccgcacgcaccgccgttgtc 1180
| | | |||||||| ||| |||||||||| ||||||||| |||||||||||
Sbjct: 233 ggaggagaagggtggcgagttgacgttcttgaacccgcacgcgccgccgttgtc 180
>gb|BQ764220.1|BQ764220 EBan01_SQ005_P04_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ005_P04 5', mRNA sequence
Length = 470
Score = 69.9 bits (35), Expect = 2e-010
Identities = 59/67 (88%)
Strand = Plus / Minus
Query: 1064 ctcgtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgt 1123
|||| |||| ||||||||||| |||||||||||||||||||||||||||||| | ||
Sbjct: 313 ctcgaagcaggagccgcagccgcggccgtccttgaagatggggacgttgccgcaggaggt 254
Query: 1124 catgccg 1130
|||||||
Sbjct: 253 catgccg 247
>gb|BQ764421.1|BQ764421 EBan01_SQ005_G21_R anther, yellow stage, no treatment, cv Optic,
EBan01 Hordeum vulgare subsp. vulgare cDNA clone
EBan01_SQ005_G21 5', mRNA sequence
Length = 538
Score = 69.9 bits (35), Expect = 2e-010
Identities = 59/67 (88%)
Strand = Plus / Minus
Query: 1064 ctcgtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgt 1123
|||| |||| ||||||||||| |||||||||||||||||||||||||||||| | ||
Sbjct: 253 ctcgaagcaggagccgcagccgcggccgtccttgaagatggggacgttgccgcaggaggt 194
Query: 1124 catgccg 1130
|||||||
Sbjct: 193 catgccg 187
>gb|BQ767787.1|BQ767787 EBro08_SQ009_H22_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ009_H22 5', mRNA sequence
Length = 631
Score = 69.9 bits (35), Expect = 2e-010
Identities = 113/139 (81%)
Strand = Plus / Minus
Query: 874 gcacccttctgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgg 933
||||||| |||||| || ||| |||||||| ||||||| | ||| |||||||| || |
Sbjct: 555 gcaccctcttgaactggatgtcgatgatgcccgagtggcggagcttctcgttgaggcccg 496
Query: 934 gctttgccagggagccgaaggccttgccgctcaagtcgaagtggtagggagcgataggct 993
||| ||||||| |||||||||| ||||||||| ||| |||||||| | |||| || |
Sbjct: 495 acttggccagggcgccgaaggccgtgccgctcaggtcaaagtggtactgggcgaccgggt 436
Query: 994 cgtagttcatgtcagtgat 1012
|||||||||||| |||||
Sbjct: 435 agtagttcatgtcggtgat 417
Score = 58.0 bits (29), Expect = 8e-007
Identities = 32/33 (96%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaa 1099
|||||| ||||||||||||||||||||||||||
Sbjct: 362 gtagcaggagccgcagcccttgccgtccttgaa 330
>gb|BU995044.1|BU995044 HM09A07r HM Hordeum vulgare subsp. vulgare cDNA clone HM09A07
5-PRIME, mRNA sequence
Length = 628
Score = 69.9 bits (35), Expect = 2e-010
Identities = 59/67 (88%)
Strand = Plus / Minus
Query: 1064 ctcgtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgt 1123
|||| |||| ||||||||||| |||||||||||||||||||||||||||||| | ||
Sbjct: 309 ctcgaagcaggagccgcagccgcggccgtccttgaagatggggacgttgccgcaggaggt 250
Query: 1124 catgccg 1130
|||||||
Sbjct: 249 catgccg 243
>gb|BI956468.1|BI956468 HVSMEn0003I18f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0003I18f,
mRNA sequence
Length = 895
Score = 67.9 bits (34), Expect = 9e-010
Identities = 55/62 (88%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacgccgtcat 1126
|||||| |||||||| |||||||| |||||||||||||| |||||||||||| |||||
Sbjct: 359 gtagcaggagccgcatcccttgccatccttgaagatgggctcgttgccgcacgatgtcat 300
Query: 1127 gc 1128
||
Sbjct: 299 gc 298
>gb|AL507275.1|AL507275 AL507275 Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Hordeum vulgare subsp. vulgare cDNA clone HY01J07V 5',
mRNA sequence
Length = 549
Score = 65.9 bits (33), Expect = 3e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacg 1119
|||||| |||||||| |||||||| |||||||||||||| ||||||||||||
Sbjct: 318 gtagcaggagccgcatcccttgccatccttgaagatgggctcgttgccgcacg 266
Score = 44.1 bits (22), Expect = 0.012
Identities = 80/98 (81%), Gaps = 1/98 (1%)
Strand = Plus / Minus
Query: 883 tgaactcgacgtccatgatgccgcagtggcgaatcttgtcg-ttgagcccgggctttgcc 941
|||||| || ||| ||||||||| |||| || | ||| ||| ||||| |||||||| |||
Sbjct: 503 tgaactggatgtcgatgatgccggagtgccggagcttctcgcttgaggccgggcttggcc 444
Query: 942 agggagccgaaggccttgccgctcaagtcgaagtggta 979
| || |||||| || |||| |||| ||||||||||||
Sbjct: 443 atggcgccgaacgcggtgccactcaggtcgaagtggta 406
>gb|BF618493.2|BF618493 HVSMEc0005N13f Hordeum vulgare seedling shoot EST library
HVcDNA0003 (Etiolated and unstressed) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEc0005N13f, mRNA sequence
Length = 798
Score = 65.9 bits (33), Expect = 3e-009
Identities = 51/57 (89%)
Strand = Plus / Minus
Query: 883 tgaactcgacgtccatgatgccgcagtggcgaatcttgtcgttgagcccgggctttg 939
||||||||| ||| ||||||||| ||||||| | |||||||||||||||||| ||||
Sbjct: 554 tgaactcgatgtcgatgatgccggagtggcggagcttgtcgttgagcccgggttttg 498
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 1054 tgcatctcacctcgtagcatgagccgcagcccttgccgtccttgaa 1099
||||||| | || ||||||||||||||| |||||||||||||||||
Sbjct: 383 tgcatctgatcttgtagcatgagccgcatcccttgccgtccttgaa 338
>gb|BI956518.1|BI956518 HVSMEn0003O09f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0003O09f,
mRNA sequence
Length = 443
Score = 65.9 bits (33), Expect = 3e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacg 1119
|||||| |||||||| |||||||| |||||||||||||| ||||||||||||
Sbjct: 328 gtagcaggagccgcatcccttgccatccttgaagatgggctcgttgccgcacg 276
>gb|BI957183.1|BI957183 HVSMEn0007P24f Hordeum vulgare rachis EST library HVcDNA0015 (normal)
Hordeum vulgare subsp. vulgare cDNA clone HVSMEn0007P24f,
mRNA sequence
Length = 844
Score = 65.9 bits (33), Expect = 3e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 1067 gtagcatgagccgcagcccttgccgtccttgaagatggggacgttgccgcacg 1119
|||||| |||||||| |||||||| |||||||||||||| ||||||||||||
Sbjct: 360 gtagcaggagccgcatcccttgccatccttgaagatgggctcgttgccgcacg 308
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 156,029
Number of Sequences: 312970
Number of extensions: 156029
Number of successful extensions: 43656
Number of sequences better than 0.5: 158
Number of HSP's better than 0.5 without gapping: 158
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43084
Number of HSP's gapped (non-prelim): 482
length of query: 1410
length of database: 175,134,539
effective HSP length: 19
effective length of query: 1391
effective length of database: 169,188,109
effective search space: 235340659619
effective search space used: 235340659619
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)