BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCL28h07.yg.2.1
(277 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, ... 46 2e-005
gb|CN815207.1|CN815207 HRO4507_A11_B21ZS5 Lib AA071E1X Aven... 34 0.061
gb|CN820684.1|CN820684 HRO4416_C12_F24ZS5 Lib AA069E1X Aven... 32 0.24
gb|CN821249.1|CN821249 HRO4423_B10_D19ZS5 Lib AA069E1X Aven... 32 0.24
>gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, mRNA, complete cds
Length = 571
Score = 46.1 bits (23), Expect = 2e-005
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 254 tacctgcccgggcggccgctcga 276
|||||||||||||||||||||||
Sbjct: 23 tacctgcccgggcggccgctcga 1
>gb|CN815207.1|CN815207 HRO4507_A11_B21ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4507_A11_B21, mRNA sequence
Length = 611
Score = 34.2 bits (17), Expect = 0.061
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 19 atgactgcccaaatatt 35
|||||||||||||||||
Sbjct: 478 atgactgcccaaatatt 462
>gb|CN820684.1|CN820684 HRO4416_C12_F24ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4416_C12_F24, mRNA
sequence
Length = 437
Score = 32.2 bits (16), Expect = 0.24
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 39 tacacaataagcaaaatcat 58
||||||||||||||| ||||
Sbjct: 378 tacacaataagcaaattcat 359
>gb|CN821249.1|CN821249 HRO4423_B10_D19ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4423_B10_D19, mRNA
sequence
Length = 568
Score = 32.2 bits (16), Expect = 0.24
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 157 attcagctcctccatg 172
||||||||||||||||
Sbjct: 227 attcagctcctccatg 212
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 700
Number of Sequences: 8143
Number of extensions: 700
Number of successful extensions: 194
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 190
Number of HSP's gapped (non-prelim): 4
length of query: 277
length of database: 4,702,463
effective HSP length: 15
effective length of query: 262
effective length of database: 4,580,318
effective search space: 1200043316
effective search space used: 1200043316
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)